Incidental Mutation 'R8495:Eef2k'
ID 658230
Institutional Source Beutler Lab
Gene Symbol Eef2k
Ensembl Gene ENSMUSG00000035064
Gene Name eukaryotic elongation factor-2 kinase
Synonyms eEF-2K
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock # R8495 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 120842831-120907450 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120887880 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 417 (L417P)
Ref Sequence ENSEMBL: ENSMUSP00000102098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047875] [ENSMUST00000106487] [ENSMUST00000106488] [ENSMUST00000106489] [ENSMUST00000146482]
AlphaFold O08796
Predicted Effect probably benign
Transcript: ENSMUST00000047875
AA Change: L417P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000046595
Gene: ENSMUSG00000035064
AA Change: L417P

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 525 562 7.2e-5 PFAM
Pfam:Sel1 564 608 2.9e-3 PFAM
Pfam:Sel1 609 645 1.3e-1 PFAM
Pfam:Sel1 665 699 1.2e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106487
SMART Domains Protein: ENSMUSP00000102096
Gene: ENSMUSG00000035064

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 1e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
Pfam:Sel1 432 472 1.8e-3 PFAM
Pfam:Sel1 474 518 7.2e-3 PFAM
Pfam:Sel1 519 555 8e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106488
AA Change: L417P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102097
Gene: ENSMUSG00000035064
AA Change: L417P

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 522 562 1.1e-3 PFAM
Pfam:Sel1 564 608 3.9e-3 PFAM
Pfam:Sel1 609 645 4.8e-2 PFAM
Pfam:Sel1 664 699 4.6e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106489
AA Change: L417P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102098
Gene: ENSMUSG00000035064
AA Change: L417P

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 522 562 1.1e-3 PFAM
Pfam:Sel1 564 608 3.9e-3 PFAM
Pfam:Sel1 609 645 4.8e-2 PFAM
Pfam:Sel1 664 699 4.6e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146482
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved protein kinase in the calmodulin-mediated signaling pathway that links activation of cell surface receptors to cell division. This kinase is involved in the regulation of protein synthesis. It phosphorylates eukaryotic elongation factor 2 (EEF2) and thus inhibits the EEF2 function. The activity of this kinase is increased in many cancers and may be a valid target for anti-cancer treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired regulation of ovarian follicular degeneration and apoptosis, prolonged estrus, and increased ovarian follicle numbers in aged females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik C T 2: 111,229,410 M1I probably null Het
4931423N10Rik A G 2: 23,207,840 E10G probably benign Het
5730480H06Rik A G 5: 48,379,357 T132A possibly damaging Het
Abcb1b T G 5: 8,865,865 V1249G probably damaging Het
Cdc5l A G 17: 45,426,523 L103P probably damaging Het
Clrn2 G T 5: 45,460,143 A119S possibly damaging Het
Cop1 A T 1: 159,250,030 H145L probably benign Het
Cyp4f13 G C 17: 32,924,859 P497R probably damaging Het
Dennd4a A G 9: 64,886,879 E660G probably damaging Het
Dhx34 T C 7: 16,218,547 Y51C probably benign Het
Dnah5 A G 15: 28,409,268 I3611V probably damaging Het
Dock2 A T 11: 34,231,622 L1647Q probably benign Het
Dpy19l4 G A 4: 11,267,659 T427M probably benign Het
Eng A G 2: 32,678,894 S477G probably benign Het
Enox1 T C 14: 77,632,572 I424T probably benign Het
Faim2 A G 15: 99,510,592 V253A probably benign Het
Farp2 A G 1: 93,603,417 I546V possibly damaging Het
Fcgbp T G 7: 28,086,553 Y472D probably damaging Het
Gm43302 A T 5: 105,276,704 C357S possibly damaging Het
Gm47189 T C 14: 41,770,096 T75A probably damaging Het
Mms22l A G 4: 24,496,908 M1V probably null Het
Myo3a A T 2: 22,396,273 I618F probably damaging Het
Nqo2 T C 13: 33,981,494 F125L probably damaging Het
Olfr1494 T A 19: 13,749,229 M41K possibly damaging Het
Pdcd6ip G A 9: 113,689,707 H162Y probably benign Het
Rad9b T C 5: 122,333,033 probably null Het
Robo3 A G 9: 37,425,368 F368S probably damaging Het
Rsph4a G A 10: 33,905,492 A113T probably benign Het
Smc2 A T 4: 52,450,992 N270I probably benign Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Spsb4 A G 9: 96,995,569 probably null Het
Spta1 G A 1: 174,215,485 R1399Q probably benign Het
Stab1 T C 14: 31,155,833 D749G probably damaging Het
Tas2r115 A T 6: 132,737,924 N21K probably damaging Het
Tbkbp1 A G 11: 97,146,603 V221A probably benign Het
Tln2 G T 9: 67,354,467 N663K probably benign Het
Tmprss11g A T 5: 86,492,260 I170K probably benign Het
Tnfrsf21 G A 17: 43,038,237 E247K probably benign Het
Trim23 T C 13: 104,201,309 Y522H probably benign Het
Vmn1r204 G A 13: 22,556,709 C170Y probably damaging Het
Vwa8 G T 14: 78,937,177 E349* probably null Het
Xpo7 A G 14: 70,670,549 probably null Het
Other mutations in Eef2k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Eef2k APN 7 120884815 unclassified probably benign
IGL01481:Eef2k APN 7 120895218 missense probably benign 0.23
IGL01935:Eef2k APN 7 120885831 missense probably damaging 1.00
IGL03109:Eef2k APN 7 120891726 missense probably damaging 1.00
R0458:Eef2k UTSW 7 120903290 missense probably damaging 0.99
R1639:Eef2k UTSW 7 120885828 missense probably damaging 1.00
R1986:Eef2k UTSW 7 120873346 missense possibly damaging 0.92
R3419:Eef2k UTSW 7 120885870 missense probably damaging 0.99
R3610:Eef2k UTSW 7 120889235 missense probably benign
R3707:Eef2k UTSW 7 120884712 missense probably damaging 1.00
R3856:Eef2k UTSW 7 120899371 nonsense probably null
R4024:Eef2k UTSW 7 120858598 missense probably benign 0.01
R4535:Eef2k UTSW 7 120858599 nonsense probably null
R4885:Eef2k UTSW 7 120891932 missense probably benign
R5137:Eef2k UTSW 7 120885422 missense probably damaging 0.99
R5137:Eef2k UTSW 7 120885423 missense probably damaging 1.00
R5501:Eef2k UTSW 7 120889248 missense probably benign 0.00
R5610:Eef2k UTSW 7 120886782 missense probably benign 0.00
R5633:Eef2k UTSW 7 120873290 intron probably benign
R7002:Eef2k UTSW 7 120891932 missense probably benign
R7166:Eef2k UTSW 7 120884772 missense probably damaging 1.00
R7254:Eef2k UTSW 7 120889265 missense probably benign 0.11
R7466:Eef2k UTSW 7 120903484 splice site probably null
R7486:Eef2k UTSW 7 120858570 missense probably benign
R7538:Eef2k UTSW 7 120891992 missense probably benign 0.29
R7593:Eef2k UTSW 7 120889268 critical splice donor site probably null
R7675:Eef2k UTSW 7 120858504 missense probably benign
R7815:Eef2k UTSW 7 120858570 missense probably benign
R7898:Eef2k UTSW 7 120895218 missense probably damaging 1.00
R8182:Eef2k UTSW 7 120873403 missense probably damaging 1.00
R8288:Eef2k UTSW 7 120903381 missense probably damaging 1.00
R8807:Eef2k UTSW 7 120891707 missense possibly damaging 0.69
R8881:Eef2k UTSW 7 120873325 missense probably damaging 1.00
R8949:Eef2k UTSW 7 120891988 missense probably damaging 0.99
R9044:Eef2k UTSW 7 120880361 missense probably damaging 1.00
R9074:Eef2k UTSW 7 120891901 missense probably damaging 1.00
R9332:Eef2k UTSW 7 120884695 missense probably benign 0.00
R9445:Eef2k UTSW 7 120858471 missense probably benign
R9605:Eef2k UTSW 7 120891947 missense probably damaging 1.00
R9777:Eef2k UTSW 7 120900230 critical splice acceptor site probably benign
Z1177:Eef2k UTSW 7 120858453 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGTGGTGCCATGATCCTTTC -3'
(R):5'- AGTCTATGTCATTCATTCTGAGAGT -3'

Sequencing Primer
(F):5'- GTGCTTCTCTTTGAAAACCAAAAGTG -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
Posted On 2021-01-18