Incidental Mutation 'R8496:Cry2'
ID 658259
Institutional Source Beutler Lab
Gene Symbol Cry2
Ensembl Gene ENSMUSG00000068742
Gene Name cryptochrome 2 (photolyase-like)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.752) question?
Stock # R8496 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 92403646-92434043 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 92426939 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Proline at position 95 (R95P)
Ref Sequence ENSEMBL: ENSMUSP00000106909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090559] [ENSMUST00000111278]
AlphaFold Q9R194
Predicted Effect probably damaging
Transcript: ENSMUST00000090559
AA Change: R95P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000088047
Gene: ENSMUSG00000068742
AA Change: R95P

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:DNA_photolyase 23 187 2.4e-50 PFAM
Pfam:FAD_binding_7 231 504 4.4e-89 PFAM
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111278
AA Change: R95P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106909
Gene: ENSMUSG00000068742
AA Change: R95P

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:DNA_photolyase 23 189 3.6e-50 PFAM
Pfam:FAD_binding_7 230 506 1.4e-105 PFAM
low complexity region 562 573 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a one-hour longer circadian period under constant darkness, and reduced expression of another circadian gene in the suprachiasmatic nucleus in response to acute light exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,143,952 D755G possibly damaging Het
A430033K04Rik A G 5: 138,646,858 E335G probably benign Het
Afp C T 5: 90,491,713 S34F probably damaging Het
Ano6 T A 15: 95,949,926 I639N probably damaging Het
Atp13a1 T G 8: 69,797,968 V411G probably damaging Het
Cadm2 A T 16: 66,664,423 C383S probably damaging Het
Capn2 T C 1: 182,477,275 I556V probably benign Het
Cd34 A G 1: 194,959,781 E322G probably benign Het
Cel T C 2: 28,556,188 D557G probably benign Het
Cemip T C 7: 83,951,426 I996V probably benign Het
Clca3a1 A T 3: 144,747,421 *514R probably null Het
Ctse T A 1: 131,664,380 I148N probably damaging Het
Cyp4f13 G C 17: 32,924,859 P497R probably damaging Het
Dsn1 C T 2: 156,997,720 V254M probably benign Het
Gm4847 T A 1: 166,642,192 H104L possibly damaging Het
Gpr88 T C 3: 116,252,468 T65A possibly damaging Het
Gtse1 A G 15: 85,862,082 D33G probably damaging Het
Ints6 A G 14: 62,705,876 Y455H probably benign Het
Kctd1 A T 18: 14,974,171 C150S probably damaging Het
Kctd11 T G 11: 69,880,051 T54P probably damaging Het
Kif1b C A 4: 149,192,611 G56* probably null Het
Kifap3 T A 1: 163,829,297 probably null Het
Naip5 G T 13: 100,212,739 H1360Q probably benign Het
Ncapd2 T C 6: 125,170,164 E1198G probably damaging Het
Nova1 T A 12: 46,713,542 K90* probably null Het
Odc1 T A 12: 17,548,395 L179H probably damaging Het
Olfr1490 T A 19: 13,655,024 H193Q probably damaging Het
Olfr1496 A G 19: 13,781,020 N136S probably benign Het
Olfr51 T C 11: 51,007,050 V26A probably benign Het
Palm C T 10: 79,806,651 T6I probably benign Het
Parp10 T A 15: 76,233,549 D879V probably damaging Het
Phf2 A G 13: 48,817,705 V497A unknown Het
Pparg A G 6: 115,463,151 I199V probably benign Het
Ppm1b T A 17: 84,994,232 I180N probably damaging Het
Prdx5 A T 19: 6,908,174 C37* probably null Het
Ptprz1 A T 6: 22,972,798 T236S probably damaging Het
Rab5b G A 10: 128,682,907 Q119* probably null Het
Rdh19 T A 10: 127,859,600 W228R probably damaging Het
Schip1 G T 3: 68,494,613 G36C probably damaging Het
Secisbp2 T C 13: 51,665,347 V321A probably damaging Het
Slc6a5 T A 7: 49,936,212 V426D probably damaging Het
Syne1 T A 10: 5,228,896 E4526V probably damaging Het
Syne1 T C 10: 5,318,441 K2083E probably damaging Het
Tecta T A 9: 42,330,251 I2143F probably benign Het
Tfap4 T C 16: 4,551,306 D90G probably damaging Het
Ttll12 T C 15: 83,577,809 Y569C probably damaging Het
Zfp326 T G 5: 105,888,585 S121A probably damaging Het
Other mutations in Cry2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Cry2 APN 2 92424632 missense probably benign 0.15
IGL02167:Cry2 APN 2 92433821 missense possibly damaging 0.93
IGL02183:Cry2 APN 2 92413039 missense probably damaging 0.99
IGL02343:Cry2 APN 2 92426921 missense possibly damaging 0.90
IGL02432:Cry2 APN 2 92413667 missense probably damaging 0.99
IGL02725:Cry2 APN 2 92413260 splice site probably benign
IGL02932:Cry2 APN 2 92413117 nonsense probably null
IGL03122:Cry2 APN 2 92413295 missense probably damaging 1.00
IGL03366:Cry2 APN 2 92413715 missense probably damaging 1.00
R0679:Cry2 UTSW 2 92413715 missense probably damaging 1.00
R1325:Cry2 UTSW 2 92413770 missense probably damaging 1.00
R1862:Cry2 UTSW 2 92424566 missense probably damaging 1.00
R1891:Cry2 UTSW 2 92413640 missense possibly damaging 0.93
R2189:Cry2 UTSW 2 92411692 missense possibly damaging 0.84
R4032:Cry2 UTSW 2 92413827 missense probably benign 0.00
R4689:Cry2 UTSW 2 92424554 missense probably benign 0.38
R5130:Cry2 UTSW 2 92424599 missense probably benign 0.28
R5145:Cry2 UTSW 2 92413060 missense probably benign
R5970:Cry2 UTSW 2 92412967 missense probably benign 0.08
R6179:Cry2 UTSW 2 92413842 missense probably damaging 0.98
R7102:Cry2 UTSW 2 92413093 missense probably damaging 0.99
R7158:Cry2 UTSW 2 92413715 missense probably damaging 1.00
R7213:Cry2 UTSW 2 92413659 missense probably benign 0.00
R7257:Cry2 UTSW 2 92412981 missense possibly damaging 0.67
R7378:Cry2 UTSW 2 92413664 missense probably damaging 1.00
R7427:Cry2 UTSW 2 92413047 missense possibly damaging 0.74
R7428:Cry2 UTSW 2 92413047 missense possibly damaging 0.74
R7440:Cry2 UTSW 2 92413638 missense probably damaging 1.00
R7531:Cry2 UTSW 2 92413005 missense probably damaging 0.98
R8234:Cry2 UTSW 2 92412629 missense probably benign
R8350:Cry2 UTSW 2 92413941 missense probably benign 0.00
R8450:Cry2 UTSW 2 92413941 missense probably benign 0.00
R9172:Cry2 UTSW 2 92413648 missense probably damaging 1.00
R9283:Cry2 UTSW 2 92413904 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCCCTAGCAGCCATTTTAG -3'
(R):5'- CGCACACCATACCAACTTGTTTAG -3'

Sequencing Primer
(F):5'- CCATTTTAGTGGCCAGACAGG -3'
(R):5'- CCAACTTGTTTAGCATGAACAGTGAC -3'
Posted On 2021-01-18