Incidental Mutation 'R8496:Afp'
ID658265
Institutional Source Beutler Lab
Gene Symbol Afp
Ensembl Gene ENSMUSG00000054932
Gene Namealpha fetoprotein
Synonymsalpha-foetoprotein
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R8496 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location90490737-90508907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 90491713 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 34 (S34F)
Ref Sequence ENSEMBL: ENSMUSP00000144019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042755] [ENSMUST00000200693]
Predicted Effect probably damaging
Transcript: ENSMUST00000042755
AA Change: S34F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041006
Gene: ENSMUSG00000054932
AA Change: S34F

DomainStartEndE-ValueType
ALBUMIN 20 201 5.33e-70 SMART
ALBUMIN 208 393 8.52e-69 SMART
ALBUMIN 400 591 6.39e-82 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200693
AA Change: S34F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144019
Gene: ENSMUSG00000054932
AA Change: S34F

DomainStartEndE-ValueType
ALBUMIN 20 121 1.4e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes alpha-fetoprotein, a major plasma protein produced by the yolk sac and the liver during fetal life. Alpha-fetoprotein expression in adults is often associated with hepatoma or teratoma. However, hereditary persistance of alpha-fetoprotein may also be found in individuals with no obvious pathology. The protein is thought to be the fetal counterpart of serum albumin, and the alpha-fetoprotein and albumin genes are present in tandem in the same transcriptional orientation on chromosome 4. Alpha-fetoprotein is found in monomeric as well as dimeric and trimeric forms, and binds copper, nickel, fatty acids and bilirubin. The level of alpha-fetoprotein in amniotic fluid is used to measure renal loss of protein to screen for spina bifida and anencephaly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Females homozygous for targeted null mutations are sterile due to impairment of the hypothalamic/pituitary system and failure of the estrus cycle resulting in anovulation. Homozygous males are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,143,952 D755G possibly damaging Het
A430033K04Rik A G 5: 138,646,858 E335G probably benign Het
Ano6 T A 15: 95,949,926 I639N probably damaging Het
Atp13a1 T G 8: 69,797,968 V411G probably damaging Het
Cadm2 A T 16: 66,664,423 C383S probably damaging Het
Capn2 T C 1: 182,477,275 I556V probably benign Het
Cd34 A G 1: 194,959,781 E322G probably benign Het
Cel T C 2: 28,556,188 D557G probably benign Het
Cemip T C 7: 83,951,426 I996V probably benign Het
Clca3a1 A T 3: 144,747,421 *514R probably null Het
Cry2 C G 2: 92,426,939 R95P probably damaging Het
Ctse T A 1: 131,664,380 I148N probably damaging Het
Cyp4f13 G C 17: 32,924,859 P497R probably damaging Het
Dsn1 C T 2: 156,997,720 V254M probably benign Het
Gm4847 T A 1: 166,642,192 H104L possibly damaging Het
Gpr88 T C 3: 116,252,468 T65A possibly damaging Het
Gtse1 A G 15: 85,862,082 D33G probably damaging Het
Ints6 A G 14: 62,705,876 Y455H probably benign Het
Kctd1 A T 18: 14,974,171 C150S probably damaging Het
Kctd11 T G 11: 69,880,051 T54P probably damaging Het
Kif1b C A 4: 149,192,611 G56* probably null Het
Kifap3 T A 1: 163,829,297 probably null Het
Naip5 G T 13: 100,212,739 H1360Q probably benign Het
Ncapd2 T C 6: 125,170,164 E1198G probably damaging Het
Nova1 T A 12: 46,713,542 K90* probably null Het
Odc1 T A 12: 17,548,395 L179H probably damaging Het
Olfr1490 T A 19: 13,655,024 H193Q probably damaging Het
Olfr1496 A G 19: 13,781,020 N136S probably benign Het
Olfr51 T C 11: 51,007,050 V26A probably benign Het
Palm C T 10: 79,806,651 T6I probably benign Het
Parp10 T A 15: 76,233,549 D879V probably damaging Het
Phf2 A G 13: 48,817,705 V497A unknown Het
Pparg A G 6: 115,463,151 I199V probably benign Het
Ppm1b T A 17: 84,994,232 I180N probably damaging Het
Prdx5 A T 19: 6,908,174 C37* probably null Het
Ptprz1 A T 6: 22,972,798 T236S probably damaging Het
Rab5b G A 10: 128,682,907 Q119* probably null Het
Rdh19 T A 10: 127,859,600 W228R probably damaging Het
Schip1 G T 3: 68,494,613 G36C probably damaging Het
Secisbp2 T C 13: 51,665,347 V321A probably damaging Het
Slc6a5 T A 7: 49,936,212 V426D probably damaging Het
Syne1 T A 10: 5,228,896 E4526V probably damaging Het
Syne1 T C 10: 5,318,441 K2083E probably damaging Het
Tecta T A 9: 42,330,251 I2143F probably benign Het
Tfap4 T C 16: 4,551,306 D90G probably damaging Het
Ttll12 T C 15: 83,577,809 Y569C probably damaging Het
Zfp326 T G 5: 105,888,585 S121A probably damaging Het
Other mutations in Afp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03261:Afp APN 5 90491751 critical splice donor site probably null
R0018:Afp UTSW 5 90506741 missense probably damaging 1.00
R0387:Afp UTSW 5 90497291 missense probably damaging 1.00
R0529:Afp UTSW 5 90504395 missense probably damaging 1.00
R1401:Afp UTSW 5 90501627 splice site probably benign
R1471:Afp UTSW 5 90503682 missense possibly damaging 0.49
R1666:Afp UTSW 5 90505068 missense probably damaging 0.99
R1800:Afp UTSW 5 90490796 missense probably benign 0.00
R2138:Afp UTSW 5 90499647 missense probably damaging 1.00
R2248:Afp UTSW 5 90501570 missense probably damaging 0.99
R4324:Afp UTSW 5 90507905 missense probably benign 0.00
R4555:Afp UTSW 5 90506687 missense possibly damaging 0.88
R5035:Afp UTSW 5 90507905 missense probably benign 0.00
R5241:Afp UTSW 5 90501614 missense probably benign 0.37
R5925:Afp UTSW 5 90497288 missense probably damaging 1.00
R6220:Afp UTSW 5 90504410 missense possibly damaging 0.78
R6719:Afp UTSW 5 90503703 missense probably benign 0.01
R8211:Afp UTSW 5 90501486 missense possibly damaging 0.73
R8960:Afp UTSW 5 90503641 missense probably benign 0.12
Z1088:Afp UTSW 5 90505015 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TCTGCAACTGATCATTCTGGTTAAC -3'
(R):5'- TGACCGAAGTTAAACATGTTGC -3'

Sequencing Primer
(F):5'- ACTGATCATTCTGGTTAACTTTGTTC -3'
(R):5'- GCTTATCAGTGTGATATTCAGCAC -3'
Posted On2021-01-18