Incidental Mutation 'R8496:A430033K04Rik'
ID658267
Institutional Source Beutler Lab
Gene Symbol A430033K04Rik
Ensembl Gene ENSMUSG00000056014
Gene NameRIKEN cDNA A430033K04 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R8496 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location138622859-138652414 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138646858 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 335 (E335G)
Ref Sequence ENSEMBL: ENSMUSP00000067316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069862] [ENSMUST00000198958]
Predicted Effect probably benign
Transcript: ENSMUST00000069862
AA Change: E335G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000067316
Gene: ENSMUSG00000056014
AA Change: E335G

DomainStartEndE-ValueType
KRAB 16 76 6.23e-34 SMART
ZnF_C2H2 261 280 1.01e2 SMART
ZnF_C2H2 455 477 1.47e-3 SMART
ZnF_C2H2 483 505 4.05e-1 SMART
ZnF_C2H2 511 533 5.5e-3 SMART
ZnF_C2H2 539 561 7.26e-3 SMART
ZnF_C2H2 567 589 5.14e-3 SMART
ZnF_C2H2 595 617 3.63e-3 SMART
ZnF_C2H2 623 645 1.92e-2 SMART
ZnF_C2H2 651 673 2.12e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198958
AA Change: E335G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142904
Gene: ENSMUSG00000056014
AA Change: E335G

DomainStartEndE-ValueType
KRAB 16 76 2.7e-36 SMART
ZnF_C2H2 261 280 4.2e-1 SMART
ZnF_C2H2 455 477 6.4e-6 SMART
ZnF_C2H2 483 505 1.8e-3 SMART
ZnF_C2H2 511 533 2.3e-5 SMART
ZnF_C2H2 539 561 3e-5 SMART
ZnF_C2H2 567 589 2.1e-5 SMART
ZnF_C2H2 595 617 1.5e-5 SMART
ZnF_C2H2 623 643 2.7e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,143,952 D755G possibly damaging Het
Afp C T 5: 90,491,713 S34F probably damaging Het
Ano6 T A 15: 95,949,926 I639N probably damaging Het
Atp13a1 T G 8: 69,797,968 V411G probably damaging Het
Cadm2 A T 16: 66,664,423 C383S probably damaging Het
Capn2 T C 1: 182,477,275 I556V probably benign Het
Cd34 A G 1: 194,959,781 E322G probably benign Het
Cel T C 2: 28,556,188 D557G probably benign Het
Cemip T C 7: 83,951,426 I996V probably benign Het
Clca3a1 A T 3: 144,747,421 *514R probably null Het
Cry2 C G 2: 92,426,939 R95P probably damaging Het
Ctse T A 1: 131,664,380 I148N probably damaging Het
Cyp4f13 G C 17: 32,924,859 P497R probably damaging Het
Dsn1 C T 2: 156,997,720 V254M probably benign Het
Gm4847 T A 1: 166,642,192 H104L possibly damaging Het
Gpr88 T C 3: 116,252,468 T65A possibly damaging Het
Gtse1 A G 15: 85,862,082 D33G probably damaging Het
Ints6 A G 14: 62,705,876 Y455H probably benign Het
Kctd1 A T 18: 14,974,171 C150S probably damaging Het
Kctd11 T G 11: 69,880,051 T54P probably damaging Het
Kif1b C A 4: 149,192,611 G56* probably null Het
Kifap3 T A 1: 163,829,297 probably null Het
Naip5 G T 13: 100,212,739 H1360Q probably benign Het
Ncapd2 T C 6: 125,170,164 E1198G probably damaging Het
Nova1 T A 12: 46,713,542 K90* probably null Het
Odc1 T A 12: 17,548,395 L179H probably damaging Het
Olfr1490 T A 19: 13,655,024 H193Q probably damaging Het
Olfr1496 A G 19: 13,781,020 N136S probably benign Het
Olfr51 T C 11: 51,007,050 V26A probably benign Het
Palm C T 10: 79,806,651 T6I probably benign Het
Parp10 T A 15: 76,233,549 D879V probably damaging Het
Phf2 A G 13: 48,817,705 V497A unknown Het
Pparg A G 6: 115,463,151 I199V probably benign Het
Ppm1b T A 17: 84,994,232 I180N probably damaging Het
Prdx5 A T 19: 6,908,174 C37* probably null Het
Ptprz1 A T 6: 22,972,798 T236S probably damaging Het
Rab5b G A 10: 128,682,907 Q119* probably null Het
Rdh19 T A 10: 127,859,600 W228R probably damaging Het
Schip1 G T 3: 68,494,613 G36C probably damaging Het
Secisbp2 T C 13: 51,665,347 V321A probably damaging Het
Slc6a5 T A 7: 49,936,212 V426D probably damaging Het
Syne1 T A 10: 5,228,896 E4526V probably damaging Het
Syne1 T C 10: 5,318,441 K2083E probably damaging Het
Tecta T A 9: 42,330,251 I2143F probably benign Het
Tfap4 T C 16: 4,551,306 D90G probably damaging Het
Ttll12 T C 15: 83,577,809 Y569C probably damaging Het
Zfp326 T G 5: 105,888,585 S121A probably damaging Het
Other mutations in A430033K04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:A430033K04Rik APN 5 138647592 missense probably damaging 1.00
IGL00336:A430033K04Rik APN 5 138647104 missense probably damaging 0.99
IGL02615:A430033K04Rik APN 5 138646140 nonsense probably null
IGL03354:A430033K04Rik APN 5 138646779 missense possibly damaging 0.85
R0172:A430033K04Rik UTSW 5 138647316 missense probably damaging 0.99
R1769:A430033K04Rik UTSW 5 138646257 missense probably benign 0.04
R4515:A430033K04Rik UTSW 5 138647744 missense probably damaging 1.00
R4903:A430033K04Rik UTSW 5 138646857 nonsense probably null
R4964:A430033K04Rik UTSW 5 138646857 nonsense probably null
R5389:A430033K04Rik UTSW 5 138646297 missense probably benign 0.02
R5769:A430033K04Rik UTSW 5 138646333 missense possibly damaging 0.86
R6128:A430033K04Rik UTSW 5 138647776 missense probably damaging 1.00
R6399:A430033K04Rik UTSW 5 138647559 missense probably damaging 1.00
R6444:A430033K04Rik UTSW 5 138639569 small deletion probably benign
R6600:A430033K04Rik UTSW 5 138647448 frame shift probably null
R6774:A430033K04Rik UTSW 5 138646450 missense probably benign
R7098:A430033K04Rik UTSW 5 138646522 missense probably benign
R7217:A430033K04Rik UTSW 5 138646926 missense probably benign
R7269:A430033K04Rik UTSW 5 138646752 missense possibly damaging 0.86
R7429:A430033K04Rik UTSW 5 138636183 missense possibly damaging 0.92
R7442:A430033K04Rik UTSW 5 138647247 missense possibly damaging 0.55
R7718:A430033K04Rik UTSW 5 138647860 missense possibly damaging 0.73
R8007:A430033K04Rik UTSW 5 138646639 missense probably benign 0.33
R8170:A430033K04Rik UTSW 5 138647053 missense possibly damaging 0.72
R8348:A430033K04Rik UTSW 5 138636252 missense probably damaging 1.00
R8520:A430033K04Rik UTSW 5 138646706 missense possibly damaging 0.72
R8778:A430033K04Rik UTSW 5 138646887 missense possibly damaging 0.53
R8858:A430033K04Rik UTSW 5 138640076 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACGCTATGCACACTGGAG -3'
(R):5'- GTGGAAAGCCTTGCTGCATG -3'

Sequencing Primer
(F):5'- CGCTATGCACACTGGAGAGAATG -3'
(R):5'- ACAGGCCTTCTCCTCTGTACAAAG -3'
Posted On2021-01-18