Mutagenetix > Incidental Mutations

Incidental Mutation 'R8496:Cemip'

658273

Institutional Source

Beutler Lab

Gene Symbol

Cemip

Ensembl Gene

ENSMUSG00000052353

Gene Name

cell migration inducing protein, hyaluronan binding

Synonyms

6330404C01Rik, 9930013L23Rik, 12H19.01.T7

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R8496 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

83932857-84086502 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 83951426 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 996 (I996V)

Ref Sequence

ENSEMBL: ENSMUSP00000063277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064174]

Predicted Effect

probably benign
Transcript: ENSMUST00000064174
AA Change: I996V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000063277
Gene: ENSMUSG00000052353
AA Change: I996V

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
G8	44	166	9.01e-42	SMART
Pfam:ILEI	187	281	2.1e-28	PFAM
Pfam:Mucin2_WxxW	324	403	1.2e-13	PFAM
PbH1	572	594	7.34e3	SMART
PbH1	595	617	3.73e3	SMART
PbH1	719	741	4.11e3	SMART
PbH1	798	819	6.96e2	SMART
Blast:PbH1	844	882	7e-17	BLAST
Blast:PbH1	917	952	2e-15	BLAST
Pfam:ILEI	1244	1334	2.7e-17	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a conditional allele activated in Schwann cells exhibit transient acceleration of postnatal myelination, reduced demyelination in culture, and reduced myelin degradation and increases remyelination following nerve axotomy or sciatic nerve crush. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	A	G	7: 28,143,952	D755G	possibly damaging	Het
A430033K04Rik	A	G	5: 138,646,858	E335G	probably benign	Het
Afp	C	T	5: 90,491,713	S34F	probably damaging	Het
Ano6	T	A	15: 95,949,926	I639N	probably damaging	Het
Atp13a1	T	G	8: 69,797,968	V411G	probably damaging	Het
Cadm2	A	T	16: 66,664,423	C383S	probably damaging	Het
Capn2	T	C	1: 182,477,275	I556V	probably benign	Het
Cd34	A	G	1: 194,959,781	E322G	probably benign	Het
Cel	T	C	2: 28,556,188	D557G	probably benign	Het
Clca3a1	A	T	3: 144,747,421	*514R	probably null	Het
Cry2	C	G	2: 92,426,939	R95P	probably damaging	Het
Ctse	T	A	1: 131,664,380	I148N	probably damaging	Het
Cyp4f13	G	C	17: 32,924,859	P497R	probably damaging	Het
Dsn1	C	T	2: 156,997,720	V254M	probably benign	Het
Gm4847	T	A	1: 166,642,192	H104L	possibly damaging	Het
Gpr88	T	C	3: 116,252,468	T65A	possibly damaging	Het
Gtse1	A	G	15: 85,862,082	D33G	probably damaging	Het
Ints6	A	G	14: 62,705,876	Y455H	probably benign	Het
Kctd1	A	T	18: 14,974,171	C150S	probably damaging	Het
Kctd11	T	G	11: 69,880,051	T54P	probably damaging	Het
Kif1b	C	A	4: 149,192,611	G56*	probably null	Het
Kifap3	T	A	1: 163,829,297		probably null	Het
Naip5	G	T	13: 100,212,739	H1360Q	probably benign	Het
Ncapd2	T	C	6: 125,170,164	E1198G	probably damaging	Het
Nova1	T	A	12: 46,713,542	K90*	probably null	Het
Odc1	T	A	12: 17,548,395	L179H	probably damaging	Het
Olfr1490	T	A	19: 13,655,024	H193Q	probably damaging	Het
Olfr1496	A	G	19: 13,781,020	N136S	probably benign	Het
Olfr51	T	C	11: 51,007,050	V26A	probably benign	Het
Palm	C	T	10: 79,806,651	T6I	probably benign	Het
Parp10	T	A	15: 76,233,549	D879V	probably damaging	Het
Phf2	A	G	13: 48,817,705	V497A	unknown	Het
Pparg	A	G	6: 115,463,151	I199V	probably benign	Het
Ppm1b	T	A	17: 84,994,232	I180N	probably damaging	Het
Prdx5	A	T	19: 6,908,174	C37*	probably null	Het
Ptprz1	A	T	6: 22,972,798	T236S	probably damaging	Het
Rab5b	G	A	10: 128,682,907	Q119*	probably null	Het
Rdh19	T	A	10: 127,859,600	W228R	probably damaging	Het
Schip1	G	T	3: 68,494,613	G36C	probably damaging	Het
Secisbp2	T	C	13: 51,665,347	V321A	probably damaging	Het
Slc6a5	T	A	7: 49,936,212	V426D	probably damaging	Het
Syne1	T	A	10: 5,228,896	E4526V	probably damaging	Het
Syne1	T	C	10: 5,318,441	K2083E	probably damaging	Het
Tecta	T	A	9: 42,330,251	I2143F	probably benign	Het
Tfap4	T	C	16: 4,551,306	D90G	probably damaging	Het
Ttll12	T	C	15: 83,577,809	Y569C	probably damaging	Het
Zfp326	T	G	5: 105,888,585	S121A	probably damaging	Het

Other mutations in Cemip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00781:Cemip	APN	7	83947280	missense	possibly damaging	0.63
IGL01520:Cemip	APN	7	83948622	missense	probably benign	0.27
IGL01646:Cemip	APN	7	83983232	missense	possibly damaging	0.81
IGL02057:Cemip	APN	7	83987453	missense	probably damaging	1.00
IGL02058:Cemip	APN	7	83997292	missense	probably damaging	0.99
IGL02120:Cemip	APN	7	83951563	missense	probably damaging	0.99
IGL02278:Cemip	APN	7	83937438	missense	probably damaging	1.00
IGL02331:Cemip	APN	7	83963984	critical splice donor site	probably null
IGL02366:Cemip	APN	7	83943641	missense	probably benign	0.08
IGL02434:Cemip	APN	7	83955284	missense	probably damaging	0.98
IGL02622:Cemip	APN	7	83964175	missense	probably damaging	1.00
IGL02958:Cemip	APN	7	83975055	missense	probably damaging	0.99
IGL02979:Cemip	APN	7	84003306	splice site	probably benign
IGL03280:Cemip	APN	7	83987330	splice site	probably benign
IGL03400:Cemip	APN	7	83958516	missense	probably damaging	0.96
IGL03134:Cemip	UTSW	7	83999237	missense	probably damaging	1.00
PIT4618001:Cemip	UTSW	7	83943939	missense	probably benign	0.07
R0149:Cemip	UTSW	7	83964010	missense	probably benign
R0212:Cemip	UTSW	7	83973190	missense	probably damaging	0.99
R0361:Cemip	UTSW	7	83964010	missense	probably benign
R0565:Cemip	UTSW	7	83964110	missense	probably damaging	0.99
R0727:Cemip	UTSW	7	83961578	missense	probably benign	0.00
R1342:Cemip	UTSW	7	83944075	nonsense	probably null
R1456:Cemip	UTSW	7	83998510	missense	possibly damaging	0.96
R1526:Cemip	UTSW	7	83951440	missense	probably damaging	1.00
R1676:Cemip	UTSW	7	83964038	missense	possibly damaging	0.77
R1718:Cemip	UTSW	7	83935658	missense	probably benign	0.00
R2234:Cemip	UTSW	7	83998562	missense	probably benign	0.02
R2513:Cemip	UTSW	7	83942025	missense	probably benign	0.11
R3788:Cemip	UTSW	7	83943898	missense	probably damaging	1.00
R3964:Cemip	UTSW	7	83951509	missense	probably benign	0.43
R3966:Cemip	UTSW	7	83951509	missense	probably benign	0.43
R4436:Cemip	UTSW	7	83987429	missense	probably null	0.43
R4584:Cemip	UTSW	7	83958539	missense	probably damaging	1.00
R4601:Cemip	UTSW	7	83951618	missense	probably damaging	0.98
R4717:Cemip	UTSW	7	83947280	missense	probably damaging	0.97
R4767:Cemip	UTSW	7	83973306	missense	probably damaging	1.00
R4822:Cemip	UTSW	7	83973241	missense	probably benign	0.27
R4849:Cemip	UTSW	7	83935737	missense	possibly damaging	0.52
R4910:Cemip	UTSW	7	83997411	missense	probably damaging	1.00
R4911:Cemip	UTSW	7	83983253	missense	probably damaging	1.00
R4922:Cemip	UTSW	7	83947100	intron	probably benign
R4924:Cemip	UTSW	7	83952938	missense	probably damaging	1.00
R5090:Cemip	UTSW	7	83942135	missense	probably damaging	1.00
R5310:Cemip	UTSW	7	83992033	missense	probably damaging	1.00
R5327:Cemip	UTSW	7	83955301	missense	probably damaging	0.99
R5378:Cemip	UTSW	7	83958525	missense	probably damaging	1.00
R5444:Cemip	UTSW	7	83982291	missense	probably damaging	0.98
R5644:Cemip	UTSW	7	83989184	missense	probably benign	0.03
R5688:Cemip	UTSW	7	83961641	missense	probably damaging	1.00
R5714:Cemip	UTSW	7	83975179	missense	probably damaging	1.00
R6170:Cemip	UTSW	7	83947230	missense	possibly damaging	0.89
R6505:Cemip	UTSW	7	83951597	nonsense	probably null
R6713:Cemip	UTSW	7	83943637	missense	probably benign	0.03
R6767:Cemip	UTSW	7	83998624	missense	probably damaging	1.00
R6817:Cemip	UTSW	7	83987992	missense	probably damaging	1.00
R6896:Cemip	UTSW	7	83998576	missense	probably damaging	1.00
R6945:Cemip	UTSW	7	83998547	missense	probably damaging	1.00
R7236:Cemip	UTSW	7	83948804	splice site	probably null
R7410:Cemip	UTSW	7	83952834	missense	probably damaging	1.00
R7483:Cemip	UTSW	7	83998576	missense	probably damaging	0.99
R7734:Cemip	UTSW	7	83957664	nonsense	probably null
R7924:Cemip	UTSW	7	83943715	splice site	probably benign
R7962:Cemip	UTSW	7	84003408	start gained	probably benign
R7988:Cemip	UTSW	7	84003408	start gained	probably benign
R7993:Cemip	UTSW	7	83964175	missense	probably damaging	1.00
R8005:Cemip	UTSW	7	84003408	start gained	probably benign
R8077:Cemip	UTSW	7	84003408	start gained	probably benign
R8130:Cemip	UTSW	7	83947176	missense	probably benign
R8131:Cemip	UTSW	7	84003408	start gained	probably benign
R8172:Cemip	UTSW	7	83997225	missense	probably damaging	1.00
R8220:Cemip	UTSW	7	83947160	missense	probably damaging	1.00
R8345:Cemip	UTSW	7	83942165	critical splice acceptor site	probably null
R8391:Cemip	UTSW	7	83955309	missense	probably damaging	0.99
R8492:Cemip	UTSW	7	83973214	missense	probably damaging	0.99
RF008:Cemip	UTSW	7	83961635	missense	probably damaging	0.99
T0970:Cemip	UTSW	7	83983146	missense	probably damaging	0.99
X0067:Cemip	UTSW	7	83947208	missense	probably damaging	0.98
Z1177:Cemip	UTSW	7	83947296	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACAGAACTTTGGCTTTTAGC -3'
(R):5'- AGAGTGTTCTTCGGAGAGCC -3'

Sequencing Primer
(F):5'- ACCCAGTACAGTGTGTTGAC -3'
(R):5'- CCGGGCCCTGGTTCAAC -3'

Posted On

2021-01-18