Incidental Mutation 'R8496:Atp13a1'
ID658274
Institutional Source Beutler Lab
Gene Symbol Atp13a1
Ensembl Gene ENSMUSG00000031862
Gene NameATPase type 13A1
SynonymsCgi152, Atp13a, catp
Accession Numbers

Ncbi RefSeq: NM_133224.2; MGI: 2180801

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8496 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location69791163-69807749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 69797968 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 411 (V411G)
Ref Sequence ENSEMBL: ENSMUSP00000034326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034326]
Predicted Effect probably damaging
Transcript: ENSMUST00000034326
AA Change: V411G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034326
Gene: ENSMUSG00000031862
AA Change: V411G

DomainStartEndE-ValueType
low complexity region 54 62 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
Pfam:E1-E2_ATPase 264 515 3.2e-24 PFAM
Pfam:Hydrolase 524 781 2.2e-11 PFAM
Pfam:HAD 527 870 2.7e-27 PFAM
low complexity region 883 894 N/A INTRINSIC
transmembrane domain 1045 1067 N/A INTRINSIC
transmembrane domain 1093 1115 N/A INTRINSIC
transmembrane domain 1130 1147 N/A INTRINSIC
low complexity region 1173 1184 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,143,952 D755G possibly damaging Het
A430033K04Rik A G 5: 138,646,858 E335G probably benign Het
Afp C T 5: 90,491,713 S34F probably damaging Het
Ano6 T A 15: 95,949,926 I639N probably damaging Het
Cadm2 A T 16: 66,664,423 C383S probably damaging Het
Capn2 T C 1: 182,477,275 I556V probably benign Het
Cd34 A G 1: 194,959,781 E322G probably benign Het
Cel T C 2: 28,556,188 D557G probably benign Het
Cemip T C 7: 83,951,426 I996V probably benign Het
Clca3a1 A T 3: 144,747,421 *514R probably null Het
Cry2 C G 2: 92,426,939 R95P probably damaging Het
Ctse T A 1: 131,664,380 I148N probably damaging Het
Cyp4f13 G C 17: 32,924,859 P497R probably damaging Het
Dsn1 C T 2: 156,997,720 V254M probably benign Het
Gm4847 T A 1: 166,642,192 H104L possibly damaging Het
Gpr88 T C 3: 116,252,468 T65A possibly damaging Het
Gtse1 A G 15: 85,862,082 D33G probably damaging Het
Ints6 A G 14: 62,705,876 Y455H probably benign Het
Kctd1 A T 18: 14,974,171 C150S probably damaging Het
Kctd11 T G 11: 69,880,051 T54P probably damaging Het
Kif1b C A 4: 149,192,611 G56* probably null Het
Kifap3 T A 1: 163,829,297 probably null Het
Naip5 G T 13: 100,212,739 H1360Q probably benign Het
Ncapd2 T C 6: 125,170,164 E1198G probably damaging Het
Nova1 T A 12: 46,713,542 K90* probably null Het
Odc1 T A 12: 17,548,395 L179H probably damaging Het
Olfr1490 T A 19: 13,655,024 H193Q probably damaging Het
Olfr1496 A G 19: 13,781,020 N136S probably benign Het
Olfr51 T C 11: 51,007,050 V26A probably benign Het
Palm C T 10: 79,806,651 T6I probably benign Het
Parp10 T A 15: 76,233,549 D879V probably damaging Het
Phf2 A G 13: 48,817,705 V497A unknown Het
Pparg A G 6: 115,463,151 I199V probably benign Het
Ppm1b T A 17: 84,994,232 I180N probably damaging Het
Prdx5 A T 19: 6,908,174 C37* probably null Het
Ptprz1 A T 6: 22,972,798 T236S probably damaging Het
Rab5b G A 10: 128,682,907 Q119* probably null Het
Rdh19 T A 10: 127,859,600 W228R probably damaging Het
Schip1 G T 3: 68,494,613 G36C probably damaging Het
Secisbp2 T C 13: 51,665,347 V321A probably damaging Het
Slc6a5 T A 7: 49,936,212 V426D probably damaging Het
Syne1 T A 10: 5,228,896 E4526V probably damaging Het
Syne1 T C 10: 5,318,441 K2083E probably damaging Het
Tecta T A 9: 42,330,251 I2143F probably benign Het
Tfap4 T C 16: 4,551,306 D90G probably damaging Het
Ttll12 T C 15: 83,577,809 Y569C probably damaging Het
Zfp326 T G 5: 105,888,585 S121A probably damaging Het
Other mutations in Atp13a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Atp13a1 APN 8 69796897 missense probably damaging 1.00
IGL00949:Atp13a1 APN 8 69800003 splice site probably benign
IGL01122:Atp13a1 APN 8 69798905 missense probably damaging 1.00
IGL02399:Atp13a1 APN 8 69807101 missense probably damaging 1.00
IGL02616:Atp13a1 APN 8 69805313 missense probably benign
IGL03073:Atp13a1 APN 8 69798502 missense probably damaging 1.00
yun_nan UTSW 8 69798679 missense probably damaging 1.00
P0005:Atp13a1 UTSW 8 69803747 missense possibly damaging 0.88
R0086:Atp13a1 UTSW 8 69797774 missense possibly damaging 0.86
R0384:Atp13a1 UTSW 8 69797324 missense possibly damaging 0.89
R0973:Atp13a1 UTSW 8 69802144 critical splice donor site probably null
R0973:Atp13a1 UTSW 8 69802144 critical splice donor site probably null
R0974:Atp13a1 UTSW 8 69802144 critical splice donor site probably null
R2010:Atp13a1 UTSW 8 69791360 missense possibly damaging 0.77
R2040:Atp13a1 UTSW 8 69807052 missense possibly damaging 0.76
R2069:Atp13a1 UTSW 8 69799773 missense probably benign 0.00
R4274:Atp13a1 UTSW 8 69805292 missense probably benign
R4288:Atp13a1 UTSW 8 69794078 missense possibly damaging 0.89
R4470:Atp13a1 UTSW 8 69798679 missense probably damaging 1.00
R5408:Atp13a1 UTSW 8 69796840 missense probably benign 0.41
R5916:Atp13a1 UTSW 8 69807098 missense probably damaging 1.00
R5920:Atp13a1 UTSW 8 69800096 missense probably benign 0.02
R5951:Atp13a1 UTSW 8 69797285 missense probably damaging 1.00
R6143:Atp13a1 UTSW 8 69805360 missense probably benign
R6467:Atp13a1 UTSW 8 69806774 missense probably damaging 1.00
R6487:Atp13a1 UTSW 8 69799878 missense probably damaging 0.99
R7166:Atp13a1 UTSW 8 69799316 splice site probably null
R7652:Atp13a1 UTSW 8 69805559 missense probably damaging 0.97
R7942:Atp13a1 UTSW 8 69807220 missense probably damaging 0.96
R8014:Atp13a1 UTSW 8 69799779 nonsense probably null
R8228:Atp13a1 UTSW 8 69798919 missense probably damaging 1.00
R8951:Atp13a1 UTSW 8 69793834 missense probably benign 0.01
RF001:Atp13a1 UTSW 8 69800070 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CGGCTGCATGTCATCTTTGG -3'
(R):5'- AACCCTGAAGCATTTACCAGAG -3'

Sequencing Primer
(F):5'- CATGTCATCTTTGGGGGCAC -3'
(R):5'- CTTAACATCAAACTCCTGGGAATGG -3'
Posted On2021-01-18