Incidental Mutation 'R8496:Odc1'
ID658283
Institutional Source Beutler Lab
Gene Symbol Odc1
Ensembl Gene ENSMUSG00000011179
Gene Nameornithine decarboxylase, structural 1
SynonymsODC
Accession Numbers

Genbank: NM_013614.2

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8496 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location17544794-17551505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17548395 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 179 (L179H)
Ref Sequence ENSEMBL: ENSMUSP00000128661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171737] [ENSMUST00000222617]
PDB Structure CRYSTAL STRUCTURE ORNITHINE DECARBOXYLASE FROM MOUSE, TRUNCATED 37 RESIDUES FROM THE C-TERMINUS, TO 1.6 ANGSTROM RESOLUTION [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000171737
AA Change: L179H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128661
Gene: ENSMUSG00000011179
AA Change: L179H

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 282 2.2e-93 PFAM
Pfam:Orn_DAP_Arg_deC 286 407 1.7e-37 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000222617
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the rate-limiting enzyme of the polyamine biosynthesis pathway which catalyzes ornithine to putrescine. The activity level for the enzyme varies in response to growth-promoting stimuli and exhibits a high turnover rate in comparison to other mammalian proteins. Originally localized to both chromosomes 2 and 7, the gene encoding this enzyme has been determined to be located on 2p25, with a pseudogene located on 7q31-qter. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous null embryos die prior to gastrulation. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(3) Gene trapped(6)  

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,143,952 D755G possibly damaging Het
A430033K04Rik A G 5: 138,646,858 E335G probably benign Het
Afp C T 5: 90,491,713 S34F probably damaging Het
Ano6 T A 15: 95,949,926 I639N probably damaging Het
Atp13a1 T G 8: 69,797,968 V411G probably damaging Het
Cadm2 A T 16: 66,664,423 C383S probably damaging Het
Capn2 T C 1: 182,477,275 I556V probably benign Het
Cd34 A G 1: 194,959,781 E322G probably benign Het
Cel T C 2: 28,556,188 D557G probably benign Het
Cemip T C 7: 83,951,426 I996V probably benign Het
Clca3a1 A T 3: 144,747,421 *514R probably null Het
Cry2 C G 2: 92,426,939 R95P probably damaging Het
Ctse T A 1: 131,664,380 I148N probably damaging Het
Cyp4f13 G C 17: 32,924,859 P497R probably damaging Het
Dsn1 C T 2: 156,997,720 V254M probably benign Het
Gm4847 T A 1: 166,642,192 H104L possibly damaging Het
Gpr88 T C 3: 116,252,468 T65A possibly damaging Het
Gtse1 A G 15: 85,862,082 D33G probably damaging Het
Ints6 A G 14: 62,705,876 Y455H probably benign Het
Kctd1 A T 18: 14,974,171 C150S probably damaging Het
Kctd11 T G 11: 69,880,051 T54P probably damaging Het
Kif1b C A 4: 149,192,611 G56* probably null Het
Kifap3 T A 1: 163,829,297 probably null Het
Naip5 G T 13: 100,212,739 H1360Q probably benign Het
Ncapd2 T C 6: 125,170,164 E1198G probably damaging Het
Nova1 T A 12: 46,713,542 K90* probably null Het
Olfr1490 T A 19: 13,655,024 H193Q probably damaging Het
Olfr1496 A G 19: 13,781,020 N136S probably benign Het
Olfr51 T C 11: 51,007,050 V26A probably benign Het
Palm C T 10: 79,806,651 T6I probably benign Het
Parp10 T A 15: 76,233,549 D879V probably damaging Het
Phf2 A G 13: 48,817,705 V497A unknown Het
Pparg A G 6: 115,463,151 I199V probably benign Het
Ppm1b T A 17: 84,994,232 I180N probably damaging Het
Prdx5 A T 19: 6,908,174 C37* probably null Het
Ptprz1 A T 6: 22,972,798 T236S probably damaging Het
Rab5b G A 10: 128,682,907 Q119* probably null Het
Rdh19 T A 10: 127,859,600 W228R probably damaging Het
Schip1 G T 3: 68,494,613 G36C probably damaging Het
Secisbp2 T C 13: 51,665,347 V321A probably damaging Het
Slc6a5 T A 7: 49,936,212 V426D probably damaging Het
Syne1 T A 10: 5,228,896 E4526V probably damaging Het
Syne1 T C 10: 5,318,441 K2083E probably damaging Het
Tecta T A 9: 42,330,251 I2143F probably benign Het
Tfap4 T C 16: 4,551,306 D90G probably damaging Het
Ttll12 T C 15: 83,577,809 Y569C probably damaging Het
Zfp326 T G 5: 105,888,585 S121A probably damaging Het
Other mutations in Odc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Odc1 APN 12 17547673 missense probably damaging 1.00
IGL02234:Odc1 APN 12 17548620 missense possibly damaging 0.95
IGL03007:Odc1 APN 12 17548810 missense probably benign 0.01
F5426:Odc1 UTSW 12 17549423 critical splice acceptor site probably null
H8562:Odc1 UTSW 12 17548037 missense probably benign 0.11
R1648:Odc1 UTSW 12 17548537 splice site probably benign
R1898:Odc1 UTSW 12 17548841 missense probably damaging 1.00
R2224:Odc1 UTSW 12 17547335 missense probably benign 0.05
R2274:Odc1 UTSW 12 17548424 missense probably benign 0.01
R3932:Odc1 UTSW 12 17548800 missense probably benign 0.38
R4883:Odc1 UTSW 12 17547385 missense possibly damaging 0.82
R4956:Odc1 UTSW 12 17547957 missense probably damaging 1.00
R5036:Odc1 UTSW 12 17548019 missense probably damaging 1.00
R6112:Odc1 UTSW 12 17549472 missense probably benign 0.23
R6261:Odc1 UTSW 12 17550654 missense probably benign 0.00
R7092:Odc1 UTSW 12 17548313 missense possibly damaging 0.90
R7101:Odc1 UTSW 12 17547318 missense probably benign
R7243:Odc1 UTSW 12 17550057 nonsense probably null
R7638:Odc1 UTSW 12 17550002 missense probably damaging 0.99
R8924:Odc1 UTSW 12 17548328 missense possibly damaging 0.93
Z1177:Odc1 UTSW 12 17550722 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGTCAGACAAGCAGCAG -3'
(R):5'- CATGTCAAACACACAGCGGG -3'

Sequencing Primer
(F):5'- GCAGCAGCACCTACACGTAG -3'
(R):5'- GGTCTCAGGATCAGTACATCCACTG -3'
Posted On2021-01-18