Incidental Mutation 'R8496:Ttll12'
ID658290
Institutional Source Beutler Lab
Gene Symbol Ttll12
Ensembl Gene ENSMUSG00000016757
Gene Nametubulin tyrosine ligase-like family, member 12
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8496 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location83575090-83595157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83577809 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 569 (Y569C)
Ref Sequence ENSEMBL: ENSMUSP00000016901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016901] [ENSMUST00000047419] [ENSMUST00000136066]
Predicted Effect probably damaging
Transcript: ENSMUST00000016901
AA Change: Y569C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016901
Gene: ENSMUSG00000016757
AA Change: Y569C

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
Pfam:TTL 341 637 7.4e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047419
SMART Domains Protein: ENSMUSP00000037039
Gene: ENSMUSG00000041736

DomainStartEndE-ValueType
Pfam:TspO_MBR 9 157 1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136066
SMART Domains Protein: ENSMUSP00000117161
Gene: ENSMUSG00000016757

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
low complexity region 66 79 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,143,952 D755G possibly damaging Het
A430033K04Rik A G 5: 138,646,858 E335G probably benign Het
Afp C T 5: 90,491,713 S34F probably damaging Het
Ano6 T A 15: 95,949,926 I639N probably damaging Het
Atp13a1 T G 8: 69,797,968 V411G probably damaging Het
Cadm2 A T 16: 66,664,423 C383S probably damaging Het
Capn2 T C 1: 182,477,275 I556V probably benign Het
Cd34 A G 1: 194,959,781 E322G probably benign Het
Cel T C 2: 28,556,188 D557G probably benign Het
Cemip T C 7: 83,951,426 I996V probably benign Het
Clca3a1 A T 3: 144,747,421 *514R probably null Het
Cry2 C G 2: 92,426,939 R95P probably damaging Het
Ctse T A 1: 131,664,380 I148N probably damaging Het
Cyp4f13 G C 17: 32,924,859 P497R probably damaging Het
Dsn1 C T 2: 156,997,720 V254M probably benign Het
Gm4847 T A 1: 166,642,192 H104L possibly damaging Het
Gpr88 T C 3: 116,252,468 T65A possibly damaging Het
Gtse1 A G 15: 85,862,082 D33G probably damaging Het
Ints6 A G 14: 62,705,876 Y455H probably benign Het
Kctd1 A T 18: 14,974,171 C150S probably damaging Het
Kctd11 T G 11: 69,880,051 T54P probably damaging Het
Kif1b C A 4: 149,192,611 G56* probably null Het
Kifap3 T A 1: 163,829,297 probably null Het
Naip5 G T 13: 100,212,739 H1360Q probably benign Het
Ncapd2 T C 6: 125,170,164 E1198G probably damaging Het
Nova1 T A 12: 46,713,542 K90* probably null Het
Odc1 T A 12: 17,548,395 L179H probably damaging Het
Olfr1490 T A 19: 13,655,024 H193Q probably damaging Het
Olfr1496 A G 19: 13,781,020 N136S probably benign Het
Olfr51 T C 11: 51,007,050 V26A probably benign Het
Palm C T 10: 79,806,651 T6I probably benign Het
Parp10 T A 15: 76,233,549 D879V probably damaging Het
Phf2 A G 13: 48,817,705 V497A unknown Het
Pparg A G 6: 115,463,151 I199V probably benign Het
Ppm1b T A 17: 84,994,232 I180N probably damaging Het
Prdx5 A T 19: 6,908,174 C37* probably null Het
Ptprz1 A T 6: 22,972,798 T236S probably damaging Het
Rab5b G A 10: 128,682,907 Q119* probably null Het
Rdh19 T A 10: 127,859,600 W228R probably damaging Het
Schip1 G T 3: 68,494,613 G36C probably damaging Het
Secisbp2 T C 13: 51,665,347 V321A probably damaging Het
Slc6a5 T A 7: 49,936,212 V426D probably damaging Het
Syne1 T A 10: 5,228,896 E4526V probably damaging Het
Syne1 T C 10: 5,318,441 K2083E probably damaging Het
Tecta T A 9: 42,330,251 I2143F probably benign Het
Tfap4 T C 16: 4,551,306 D90G probably damaging Het
Zfp326 T G 5: 105,888,585 S121A probably damaging Het
Other mutations in Ttll12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Ttll12 APN 15 83578656 missense probably benign 0.15
IGL00942:Ttll12 APN 15 83582448 missense possibly damaging 0.65
IGL01746:Ttll12 APN 15 83578676 missense probably damaging 1.00
IGL02102:Ttll12 APN 15 83582063 missense probably damaging 1.00
IGL02475:Ttll12 APN 15 83587101 missense probably damaging 1.00
IGL02484:Ttll12 APN 15 83581696 missense possibly damaging 0.94
R0403:Ttll12 UTSW 15 83580658 splice site probably benign
R1477:Ttll12 UTSW 15 83580102 missense probably damaging 1.00
R1530:Ttll12 UTSW 15 83588655 missense probably damaging 1.00
R1925:Ttll12 UTSW 15 83581775 missense probably benign 0.06
R3508:Ttll12 UTSW 15 83580630 missense probably damaging 0.98
R3972:Ttll12 UTSW 15 83582096 missense probably damaging 1.00
R4198:Ttll12 UTSW 15 83577013 missense probably damaging 1.00
R4200:Ttll12 UTSW 15 83577013 missense probably damaging 1.00
R4357:Ttll12 UTSW 15 83581757 missense probably damaging 1.00
R4740:Ttll12 UTSW 15 83580120 missense probably damaging 1.00
R5024:Ttll12 UTSW 15 83587113 missense probably damaging 1.00
R5870:Ttll12 UTSW 15 83577036 missense probably damaging 0.97
R6824:Ttll12 UTSW 15 83591377 critical splice donor site probably null
R7034:Ttll12 UTSW 15 83586885 missense probably benign
R7036:Ttll12 UTSW 15 83586885 missense probably benign
R7447:Ttll12 UTSW 15 83586975 missense probably damaging 1.00
R8721:Ttll12 UTSW 15 83580583 missense probably damaging 1.00
Z1088:Ttll12 UTSW 15 83582078 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACCTGGCTAATTATCCAGTG -3'
(R):5'- ATCTTCAGGACAGGGTTCAGG -3'

Sequencing Primer
(F):5'- TTGAGTTCCTAGAATCCACAAGGCG -3'
(R):5'- TTCAGGCAAGGATAGTGGGCC -3'
Posted On2021-01-18