Incidental Mutation 'R8496:Ano6'
ID658292
Institutional Source Beutler Lab
Gene Symbol Ano6
Ensembl Gene ENSMUSG00000064210
Gene Nameanoctamin 6
SynonymsTmem16f, 2900059G15Rik, F730003B03Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R8496 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location95790843-95974751 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95949926 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 639 (I639N)
Ref Sequence ENSEMBL: ENSMUSP00000153954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071874] [ENSMUST00000227151] [ENSMUST00000227791]
Predicted Effect probably damaging
Transcript: ENSMUST00000071874
AA Change: I618N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071770
Gene: ENSMUSG00000064210
AA Change: I618N

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
Pfam:Anoct_dimer 63 285 4.5e-70 PFAM
Pfam:Anoctamin 288 872 3.3e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227151
Predicted Effect probably damaging
Transcript: ENSMUST00000227791
AA Change: I639N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass transmembrane protein that belongs to the anoctamin family. This protein is an essential component for the calcium-dependent exposure of phosphatidylserine on the cell surface. The scrambling of phospholipid occurs in various biological systems, such as when blood platelets are activated, they expose phosphatidylserine to trigger the clotting system. Mutations in this gene are associated with Scott syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired platelet coagulation with increased bleeding time. Mice homozygous for a different knock out allele or gene trap exhibit decreased bone mineral deposition and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,143,952 D755G possibly damaging Het
A430033K04Rik A G 5: 138,646,858 E335G probably benign Het
Afp C T 5: 90,491,713 S34F probably damaging Het
Atp13a1 T G 8: 69,797,968 V411G probably damaging Het
Cadm2 A T 16: 66,664,423 C383S probably damaging Het
Capn2 T C 1: 182,477,275 I556V probably benign Het
Cd34 A G 1: 194,959,781 E322G probably benign Het
Cel T C 2: 28,556,188 D557G probably benign Het
Cemip T C 7: 83,951,426 I996V probably benign Het
Clca3a1 A T 3: 144,747,421 *514R probably null Het
Cry2 C G 2: 92,426,939 R95P probably damaging Het
Ctse T A 1: 131,664,380 I148N probably damaging Het
Cyp4f13 G C 17: 32,924,859 P497R probably damaging Het
Dsn1 C T 2: 156,997,720 V254M probably benign Het
Gm4847 T A 1: 166,642,192 H104L possibly damaging Het
Gpr88 T C 3: 116,252,468 T65A possibly damaging Het
Gtse1 A G 15: 85,862,082 D33G probably damaging Het
Ints6 A G 14: 62,705,876 Y455H probably benign Het
Kctd1 A T 18: 14,974,171 C150S probably damaging Het
Kctd11 T G 11: 69,880,051 T54P probably damaging Het
Kif1b C A 4: 149,192,611 G56* probably null Het
Kifap3 T A 1: 163,829,297 probably null Het
Naip5 G T 13: 100,212,739 H1360Q probably benign Het
Ncapd2 T C 6: 125,170,164 E1198G probably damaging Het
Nova1 T A 12: 46,713,542 K90* probably null Het
Odc1 T A 12: 17,548,395 L179H probably damaging Het
Olfr1490 T A 19: 13,655,024 H193Q probably damaging Het
Olfr1496 A G 19: 13,781,020 N136S probably benign Het
Olfr51 T C 11: 51,007,050 V26A probably benign Het
Palm C T 10: 79,806,651 T6I probably benign Het
Parp10 T A 15: 76,233,549 D879V probably damaging Het
Phf2 A G 13: 48,817,705 V497A unknown Het
Pparg A G 6: 115,463,151 I199V probably benign Het
Ppm1b T A 17: 84,994,232 I180N probably damaging Het
Prdx5 A T 19: 6,908,174 C37* probably null Het
Ptprz1 A T 6: 22,972,798 T236S probably damaging Het
Rab5b G A 10: 128,682,907 Q119* probably null Het
Rdh19 T A 10: 127,859,600 W228R probably damaging Het
Schip1 G T 3: 68,494,613 G36C probably damaging Het
Secisbp2 T C 13: 51,665,347 V321A probably damaging Het
Slc6a5 T A 7: 49,936,212 V426D probably damaging Het
Syne1 T A 10: 5,228,896 E4526V probably damaging Het
Syne1 T C 10: 5,318,441 K2083E probably damaging Het
Tecta T A 9: 42,330,251 I2143F probably benign Het
Tfap4 T C 16: 4,551,306 D90G probably damaging Het
Ttll12 T C 15: 83,577,809 Y569C probably damaging Het
Zfp326 T G 5: 105,888,585 S121A probably damaging Het
Other mutations in Ano6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Ano6 APN 15 95948429 missense probably damaging 1.00
IGL01308:Ano6 APN 15 95913661 splice site probably null
IGL01490:Ano6 APN 15 95948410 missense probably benign 0.08
IGL01663:Ano6 APN 15 95967614 splice site probably null
IGL01783:Ano6 APN 15 95962262 missense possibly damaging 0.94
IGL02040:Ano6 APN 15 95955944 missense probably benign 0.00
IGL02114:Ano6 APN 15 95943460 missense probably damaging 0.96
IGL02683:Ano6 APN 15 95948312 missense probably damaging 1.00
IGL03297:Ano6 APN 15 95962277 missense probably damaging 1.00
IGL03401:Ano6 APN 15 95949905 missense probably damaging 1.00
R0730:Ano6 UTSW 15 95920371 missense probably damaging 1.00
R1086:Ano6 UTSW 15 95949962 splice site probably null
R1264:Ano6 UTSW 15 95949566 missense probably damaging 1.00
R1421:Ano6 UTSW 15 95913385 missense probably benign 0.13
R1494:Ano6 UTSW 15 95972507 missense probably damaging 0.98
R1755:Ano6 UTSW 15 95972570 missense possibly damaging 0.74
R1757:Ano6 UTSW 15 95962267 missense probably damaging 1.00
R2042:Ano6 UTSW 15 95956023 critical splice donor site probably null
R2393:Ano6 UTSW 15 95966025 critical splice donor site probably benign
R2415:Ano6 UTSW 15 95962280 missense probably damaging 1.00
R2483:Ano6 UTSW 15 95965974 missense probably benign 0.00
R2879:Ano6 UTSW 15 95943427 nonsense probably null
R3440:Ano6 UTSW 15 95967721 missense probably damaging 1.00
R3716:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3717:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3718:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3887:Ano6 UTSW 15 95894449 missense possibly damaging 0.64
R4175:Ano6 UTSW 15 95962169 missense probably damaging 1.00
R4214:Ano6 UTSW 15 95965909 missense probably benign
R4591:Ano6 UTSW 15 95943427 nonsense probably null
R5249:Ano6 UTSW 15 95913588 missense probably benign 0.35
R5383:Ano6 UTSW 15 95916037 missense probably benign 0.00
R5496:Ano6 UTSW 15 95967614 splice site probably null
R5532:Ano6 UTSW 15 95962241 missense probably damaging 1.00
R5598:Ano6 UTSW 15 95941347 missense probably damaging 1.00
R5645:Ano6 UTSW 15 95920351 missense probably benign 0.03
R5739:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R5794:Ano6 UTSW 15 95894524 missense probably benign 0.00
R5864:Ano6 UTSW 15 95920380 critical splice donor site probably null
R5936:Ano6 UTSW 15 95972601 missense probably damaging 1.00
R5937:Ano6 UTSW 15 95913957 missense probably damaging 0.98
R6063:Ano6 UTSW 15 95948417 missense probably damaging 1.00
R6191:Ano6 UTSW 15 95948499 critical splice donor site probably null
R6275:Ano6 UTSW 15 95913433 missense probably damaging 1.00
R6349:Ano6 UTSW 15 95966022 missense probably damaging 0.97
R6468:Ano6 UTSW 15 95967714 missense probably benign 0.01
R6734:Ano6 UTSW 15 95949536 missense probably damaging 0.99
R6830:Ano6 UTSW 15 95894461 missense probably damaging 1.00
R6883:Ano6 UTSW 15 95962111 missense probably damaging 1.00
R6892:Ano6 UTSW 15 95967624 missense probably damaging 1.00
R7171:Ano6 UTSW 15 95920291 missense probably damaging 1.00
R7271:Ano6 UTSW 15 95913900 missense probably damaging 1.00
R7284:Ano6 UTSW 15 95948303 missense probably damaging 1.00
R7326:Ano6 UTSW 15 95864244 missense possibly damaging 0.95
R7937:Ano6 UTSW 15 95972589 missense probably damaging 1.00
R7944:Ano6 UTSW 15 95941309 missense probably damaging 1.00
R7945:Ano6 UTSW 15 95941309 missense probably damaging 1.00
R7954:Ano6 UTSW 15 95965821 missense possibly damaging 0.93
X0066:Ano6 UTSW 15 95943434 missense probably damaging 0.99
Z1176:Ano6 UTSW 15 95913460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCTGCCTAATGAATAGTGAC -3'
(R):5'- CATAACAAACTCCCCGGTTGG -3'

Sequencing Primer
(F):5'- GCCTAATGAATAGTGACTTCCTTGTG -3'
(R):5'- TGGACCTTTTGCCCAGAGG -3'
Posted On2021-01-18