Incidental Mutation 'R8496:Cyp4f13'
ID658295
Institutional Source Beutler Lab
Gene Symbol Cyp4f13
Ensembl Gene ENSMUSG00000024055
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 13
Synonyms0610030I10Rik, P450 CYP4F13, leukotriene B4 omega hydroxylase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R8496 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location32924688-32947402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 32924859 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 497 (P497R)
Ref Sequence ENSEMBL: ENSMUSP00000074733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075253] [ENSMUST00000137222] [ENSMUST00000139353]
Predicted Effect probably damaging
Transcript: ENSMUST00000075253
AA Change: P497R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074733
Gene: ENSMUSG00000024055
AA Change: P497R

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 52 514 1.9e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137222
SMART Domains Protein: ENSMUSP00000123495
Gene: ENSMUSG00000024055

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SCOP:d1e9xa_ 48 115 1e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139353
AA Change: P388R

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123282
Gene: ENSMUSG00000024055
AA Change: P388R

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 60 405 7.8e-108 PFAM
Meta Mutation Damage Score 0.5716 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP4F3, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. The enzyme starts the process of inactivating and degrading leukotriene B4, a potent mediator of inflammation. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F8, is approximately 18 kb away. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,143,952 D755G possibly damaging Het
A430033K04Rik A G 5: 138,646,858 E335G probably benign Het
Afp C T 5: 90,491,713 S34F probably damaging Het
Ano6 T A 15: 95,949,926 I639N probably damaging Het
Atp13a1 T G 8: 69,797,968 V411G probably damaging Het
Cadm2 A T 16: 66,664,423 C383S probably damaging Het
Capn2 T C 1: 182,477,275 I556V probably benign Het
Cd34 A G 1: 194,959,781 E322G probably benign Het
Cel T C 2: 28,556,188 D557G probably benign Het
Cemip T C 7: 83,951,426 I996V probably benign Het
Clca3a1 A T 3: 144,747,421 *514R probably null Het
Cry2 C G 2: 92,426,939 R95P probably damaging Het
Ctse T A 1: 131,664,380 I148N probably damaging Het
Dsn1 C T 2: 156,997,720 V254M probably benign Het
Gm4847 T A 1: 166,642,192 H104L possibly damaging Het
Gpr88 T C 3: 116,252,468 T65A possibly damaging Het
Gtse1 A G 15: 85,862,082 D33G probably damaging Het
Ints6 A G 14: 62,705,876 Y455H probably benign Het
Kctd1 A T 18: 14,974,171 C150S probably damaging Het
Kctd11 T G 11: 69,880,051 T54P probably damaging Het
Kif1b C A 4: 149,192,611 G56* probably null Het
Kifap3 T A 1: 163,829,297 probably null Het
Naip5 G T 13: 100,212,739 H1360Q probably benign Het
Ncapd2 T C 6: 125,170,164 E1198G probably damaging Het
Nova1 T A 12: 46,713,542 K90* probably null Het
Odc1 T A 12: 17,548,395 L179H probably damaging Het
Olfr1490 T A 19: 13,655,024 H193Q probably damaging Het
Olfr1496 A G 19: 13,781,020 N136S probably benign Het
Olfr51 T C 11: 51,007,050 V26A probably benign Het
Palm C T 10: 79,806,651 T6I probably benign Het
Parp10 T A 15: 76,233,549 D879V probably damaging Het
Phf2 A G 13: 48,817,705 V497A unknown Het
Pparg A G 6: 115,463,151 I199V probably benign Het
Ppm1b T A 17: 84,994,232 I180N probably damaging Het
Prdx5 A T 19: 6,908,174 C37* probably null Het
Ptprz1 A T 6: 22,972,798 T236S probably damaging Het
Rab5b G A 10: 128,682,907 Q119* probably null Het
Rdh19 T A 10: 127,859,600 W228R probably damaging Het
Schip1 G T 3: 68,494,613 G36C probably damaging Het
Secisbp2 T C 13: 51,665,347 V321A probably damaging Het
Slc6a5 T A 7: 49,936,212 V426D probably damaging Het
Syne1 T A 10: 5,228,896 E4526V probably damaging Het
Syne1 T C 10: 5,318,441 K2083E probably damaging Het
Tecta T A 9: 42,330,251 I2143F probably benign Het
Tfap4 T C 16: 4,551,306 D90G probably damaging Het
Ttll12 T C 15: 83,577,809 Y569C probably damaging Het
Zfp326 T G 5: 105,888,585 S121A probably damaging Het
Other mutations in Cyp4f13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Cyp4f13 APN 17 32941164 missense probably benign 0.00
IGL01835:Cyp4f13 APN 17 32930614 missense probably benign 0.39
IGL02234:Cyp4f13 APN 17 32924774 utr 3 prime probably benign
IGL02437:Cyp4f13 APN 17 32930608 missense probably benign 0.12
IGL02465:Cyp4f13 APN 17 32929136 critical splice donor site probably null
IGL02604:Cyp4f13 APN 17 32932421 missense probably benign 0.01
IGL02934:Cyp4f13 APN 17 32929871 missense probably damaging 1.00
IGL03177:Cyp4f13 APN 17 32946914 missense possibly damaging 0.88
R0117:Cyp4f13 UTSW 17 32930606 missense probably damaging 0.98
R0138:Cyp4f13 UTSW 17 32941106 missense possibly damaging 0.63
R0220:Cyp4f13 UTSW 17 32929502 missense probably damaging 1.00
R0243:Cyp4f13 UTSW 17 32924969 splice site probably benign
R0357:Cyp4f13 UTSW 17 32932651 nonsense probably null
R1078:Cyp4f13 UTSW 17 32925568 missense probably damaging 1.00
R1757:Cyp4f13 UTSW 17 32929958 missense probably damaging 1.00
R1990:Cyp4f13 UTSW 17 32925568 missense probably damaging 1.00
R2351:Cyp4f13 UTSW 17 32925596 missense probably benign 0.01
R4704:Cyp4f13 UTSW 17 32925735 missense probably damaging 1.00
R4865:Cyp4f13 UTSW 17 32925704 missense probably damaging 1.00
R5004:Cyp4f13 UTSW 17 32925786 missense probably benign 0.39
R5310:Cyp4f13 UTSW 17 32925821 missense probably damaging 1.00
R5574:Cyp4f13 UTSW 17 32929205 missense probably benign 0.39
R5996:Cyp4f13 UTSW 17 32929473 missense possibly damaging 0.87
R6190:Cyp4f13 UTSW 17 32929873 missense probably damaging 1.00
R8254:Cyp4f13 UTSW 17 32929933 missense probably benign 0.04
R8495:Cyp4f13 UTSW 17 32924859 missense probably damaging 1.00
R8498:Cyp4f13 UTSW 17 32924859 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCATAGTCACTCAAAGAACAGGAGG -3'
(R):5'- TAGGCCAGGTCCCAGAAATG -3'

Sequencing Primer
(F):5'- AGAACAGGAGGCAGTTCTGTTTATTC -3'
(R):5'- CAGGTCCCAGAAATGCGGAC -3'
Posted On2021-01-18