Mutagenetix > Incidental Mutation

Incidental Mutation 'R8497:Itgav'

658303

Institutional Source

Beutler Lab

Gene Symbol

Itgav

Ensembl Gene

ENSMUSG00000027087

Gene Name

integrin alpha V

Synonyms

alphav-integrin, CD51, 1110004F14Rik, 2610028E01Rik, vitronectin receptor alpha polypeptide (VNRA), D430040G12Rik

MMRRC Submission

067939-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8497 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83724397-83806916 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 83785461 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 529 (C529S)

Ref Sequence

ENSEMBL: ENSMUSP00000107369 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028499] [ENSMUST00000111740]

AlphaFold

P43406

Predicted Effect

probably damaging
Transcript: ENSMUST00000028499
AA Change: C565S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087
AA Change: C565S

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	248	298	4.9e-13	SMART
Int_alpha	302	363	4.55e-8	SMART
Int_alpha	366	422	2.2e-15	SMART
Int_alpha	430	484	1.62e-4	SMART
SCOP:d1m1xa2	629	767	3e-49	SMART
SCOP:d1m1xa3	768	982	1e-89	SMART
low complexity region	995	1008	N/A	INTRINSIC
Pfam:Integrin_alpha	1013	1027	3.9e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111740
AA Change: C529S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087
AA Change: C529S

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	212	262	4.9e-13	SMART
Int_alpha	266	327	4.55e-8	SMART
Int_alpha	330	386	2.2e-15	SMART
Int_alpha	394	448	1.62e-4	SMART
SCOP:d1m1xa2	593	731	5e-49	SMART
SCOP:d1m1xa3	732	946	2e-89	SMART
low complexity region	959	972	N/A	INTRINSIC
Pfam:Integrin_alpha	977	991	1.3e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 1, beta 3, beta 6 and beta 8. The heterodimer of alpha v and beta 3 forms the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. In mouse, deficiency of this gene is associated with defects in vascular morphogenesis in the brain and early post-natal death. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit placental defects, intracerebral and intestinal hemorrhages, and cleft palate, resulting in death occurring as early as midgestation and as late as shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1cf	C	T	19: 31,945,850	H509Y	probably benign	Het
Afm	A	T	5: 90,551,343		probably null	Het
Apc	G	A	18: 34,313,030	C975Y	possibly damaging	Het
Ash1l	G	T	3: 89,007,644	M1860I	probably benign	Het
Bdkrb1	C	T	12: 105,604,204	Q10*	probably null	Het
Bphl	A	G	13: 34,037,723	K21E	possibly damaging	Het
Cadps2	T	C	6: 23,355,919	N837D	probably benign	Het
Cat	C	G	2: 103,456,876	A470P	probably damaging	Het
Ccdc129	A	T	6: 55,898,194	R376S	probably benign	Het
Cdc34	G	T	10: 79,685,011	D11Y	probably damaging	Het
Cep290	A	G	10: 100,551,458	E1936G	probably damaging	Het
Cnot6	A	T	11: 49,675,364	N501K	possibly damaging	Het
Cyth3	A	C	5: 143,692,573	D44A	probably benign	Het
Dchs1	C	T	7: 105,758,961	G1888D	probably damaging	Het
Fam160a2	G	T	7: 105,381,189	D820E	probably damaging	Het
Ffar1	T	G	7: 30,860,909	I188L	probably benign	Het
Gm10696	T	A	3: 94,175,812	I231F	possibly damaging	Het
Gpr17	A	G	18: 31,947,120	Y297H	probably damaging	Het
H2-M10.5	A	C	17: 36,773,837	E151A	probably damaging	Het
Hmcn1	C	T	1: 150,580,239	R5310K	probably benign	Het
Hmcn2	T	C	2: 31,423,345	L3522P	possibly damaging	Het
Hs2st1	T	G	3: 144,434,691	T290P	probably damaging	Het
Il5ra	G	A	6: 106,738,105	L231F	probably benign	Het
Lrrcc1	A	G	3: 14,539,984	D138G	possibly damaging	Het
Mat1a	C	T	14: 41,121,894	R357W	probably damaging	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Mtss1l	T	C	8: 110,738,590	V492A	possibly damaging	Het
Nalcn	A	G	14: 123,515,359	V330A	probably damaging	Het
Neu3	A	T	7: 99,823,135		probably null	Het
Nfx1	A	G	4: 40,976,968	D214G	possibly damaging	Het
Olfr1306	T	A	2: 111,912,619	I104F	possibly damaging	Het
Olfr1390	G	A	11: 49,340,894	D121N	probably damaging	Het
Olfr1457	T	C	19: 13,095,343	T102A	probably benign	Het
Olfr237-ps1	T	C	6: 43,153,884	L193P	probably damaging	Het
Pcdhb14	A	T	18: 37,449,296	H485L	probably benign	Het
Pdss2	A	C	10: 43,413,525	K342T	possibly damaging	Het
Ppargc1a	A	G	5: 51,490,228	S254P	probably damaging	Het
Prelid1	A	G	13: 55,323,020	D87G	probably damaging	Het
Prkg1	C	A	19: 31,302,309	C190F	probably damaging	Het
Psmb5	A	G	14: 54,614,380	S116P	possibly damaging	Het
Rassf6	A	G	5: 90,631,532	V14A	possibly damaging	Het
Ripk1	T	C	13: 34,027,951	S415P	probably damaging	Het
Rnft1	A	T	11: 86,495,306	K344*	probably null	Het
Sacs	G	A	14: 61,192,253	R587Q	probably benign	Het
Skp2	A	T	15: 9,127,884		probably null	Het
Spata31d1a	T	C	13: 59,701,174	K1047E	possibly damaging	Het
Szt2	G	A	4: 118,388,321	T1098I	possibly damaging	Het
Tcf20	A	G	15: 82,855,951	M433T	probably benign	Het
Tsen54	T	C	11: 115,822,584	F438L	probably damaging	Het
Utp23	C	T	15: 51,882,218	T144I	probably damaging	Het
Vmn2r105	T	C	17: 20,234,872	M1V	probably null	Het
Wdfy4	C	T	14: 32,966,399	V2926M	probably damaging	Het
Zfp407	T	C	18: 84,559,896	K1031E	probably damaging	Het

Other mutations in Itgav

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Itgav	APN	2	83802995	missense	probably damaging	1.00
IGL01969:Itgav	APN	2	83803283	missense	probably damaging	1.00
IGL02371:Itgav	APN	2	83770053	missense	probably damaging	1.00
IGL02563:Itgav	APN	2	83771236	missense	probably benign
IGL02640:Itgav	APN	2	83791939	missense	probably benign	0.33
IGL02641:Itgav	APN	2	83768345	splice site	probably benign
IGL02927:Itgav	APN	2	83795540	missense	probably damaging	1.00
IGL03172:Itgav	APN	2	83765846	missense	possibly damaging	0.51
R0158:Itgav	UTSW	2	83792037	missense	probably benign	0.33
R0346:Itgav	UTSW	2	83792609	missense	probably damaging	1.00
R0508:Itgav	UTSW	2	83792658	splice site	probably benign
R0546:Itgav	UTSW	2	83803242	missense	probably benign	0.04
R0554:Itgav	UTSW	2	83794270	missense	possibly damaging	0.95
R1122:Itgav	UTSW	2	83791939	missense	probably benign	0.33
R1468:Itgav	UTSW	2	83765901	splice site	probably benign
R1566:Itgav	UTSW	2	83736630	missense	probably damaging	1.00
R1657:Itgav	UTSW	2	83801779	missense	probably benign	0.21
R1892:Itgav	UTSW	2	83771336	missense	probably damaging	1.00
R1912:Itgav	UTSW	2	83795486	missense	possibly damaging	0.85
R2176:Itgav	UTSW	2	83803255	missense	probably damaging	1.00
R2438:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R2449:Itgav	UTSW	2	83768750	critical splice donor site	probably null
R3110:Itgav	UTSW	2	83792571	nonsense	probably null
R3112:Itgav	UTSW	2	83792571	nonsense	probably null
R3176:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3177:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3276:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3277:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3766:Itgav	UTSW	2	83801885	critical splice donor site	probably null
R3774:Itgav	UTSW	2	83791964	missense	probably damaging	1.00
R3880:Itgav	UTSW	2	83768301	missense	probably damaging	1.00
R4196:Itgav	UTSW	2	83768327	missense	probably benign	0.24
R4287:Itgav	UTSW	2	83724840	nonsense	probably null
R4620:Itgav	UTSW	2	83755902	missense	probably benign	0.07
R4790:Itgav	UTSW	2	83755810	missense	probably damaging	1.00
R4946:Itgav	UTSW	2	83788983	missense	probably benign	0.16
R6150:Itgav	UTSW	2	83776436	missense	probably benign
R6345:Itgav	UTSW	2	83802036	missense	probably damaging	1.00
R6482:Itgav	UTSW	2	83794270	missense	probably damaging	1.00
R6900:Itgav	UTSW	2	83803247	missense	probably damaging	1.00
R7247:Itgav	UTSW	2	83724835	missense	probably damaging	0.98
R7317:Itgav	UTSW	2	83794983	missense	probably benign	0.12
R7429:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7430:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7522:Itgav	UTSW	2	83802029	missense	probably benign	0.10
R7546:Itgav	UTSW	2	83776550	nonsense	probably null
R7578:Itgav	UTSW	2	83747875	missense	probably benign	0.16
R8311:Itgav	UTSW	2	83765777	missense	probably damaging	1.00
R8744:Itgav	UTSW	2	83770083	missense	probably benign	0.25
R9752:Itgav	UTSW	2	83770107	critical splice donor site	probably null
V1662:Itgav	UTSW	2	83783854	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- CCTGCAGGAAAAGTCTAGATTGC -3'
(R):5'- TGGCTTTGACACTGACTGG -3'

Sequencing Primer
(F):5'- CAGGAAAAGTCTAGATTGCTAGGAC -3'
(R):5'- GCTTTGACACTGACTGGAAAAGCC -3'

Posted On

2021-01-18