Incidental Mutation 'R8497:Rassf6'
ID 658314
Institutional Source Beutler Lab
Gene Symbol Rassf6
Ensembl Gene ENSMUSG00000029370
Gene Name Ras association (RalGDS/AF-6) domain family member 6
Synonyms 1600016B17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R8497 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 90603076-90640657 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90631532 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 14 (V14A)
Ref Sequence ENSEMBL: ENSMUSP00000144337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031317] [ENSMUST00000201121] [ENSMUST00000201370] [ENSMUST00000202704] [ENSMUST00000202784]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000031317
AA Change: V14A

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031317
Gene: ENSMUSG00000029370
AA Change: V14A

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000201121
AA Change: V14A
Predicted Effect unknown
Transcript: ENSMUST00000201370
AA Change: V14A
SMART Domains Protein: ENSMUSP00000144199
Gene: ENSMUSG00000029370
AA Change: V14A

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202704
AA Change: V14A

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144532
Gene: ENSMUSG00000029370
AA Change: V14A

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000202784
AA Change: V14A

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144337
Gene: ENSMUSG00000029370
AA Change: V14A

DomainStartEndE-ValueType
low complexity region 126 135 N/A INTRINSIC
RA 175 265 2.67e-9 SMART
Pfam:Nore1-SARAH 277 316 8.6e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-association domain family (RASSF). Members of this family form the core of a highly conserved tumor suppressor network, the Salvador-Warts-Hippo (SWH) pathway. The protein encoded by this gene is a Ras effector protein that induces apoptosis. A genomic region containing this gene has been linked to susceptibility to viral bronchiolitis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,945,850 H509Y probably benign Het
Afm A T 5: 90,551,343 probably null Het
Apc G A 18: 34,313,030 C975Y possibly damaging Het
Ash1l G T 3: 89,007,644 M1860I probably benign Het
Bdkrb1 C T 12: 105,604,204 Q10* probably null Het
Bphl A G 13: 34,037,723 K21E possibly damaging Het
Cadps2 T C 6: 23,355,919 N837D probably benign Het
Cat C G 2: 103,456,876 A470P probably damaging Het
Ccdc129 A T 6: 55,898,194 R376S probably benign Het
Cdc34 G T 10: 79,685,011 D11Y probably damaging Het
Cep290 A G 10: 100,551,458 E1936G probably damaging Het
Cnot6 A T 11: 49,675,364 N501K possibly damaging Het
Cyth3 A C 5: 143,692,573 D44A probably benign Het
Dchs1 C T 7: 105,758,961 G1888D probably damaging Het
Fam160a2 G T 7: 105,381,189 D820E probably damaging Het
Ffar1 T G 7: 30,860,909 I188L probably benign Het
Gm10696 T A 3: 94,175,812 I231F possibly damaging Het
Gpr17 A G 18: 31,947,120 Y297H probably damaging Het
H2-M10.5 A C 17: 36,773,837 E151A probably damaging Het
Hmcn1 C T 1: 150,580,239 R5310K probably benign Het
Hmcn2 T C 2: 31,423,345 L3522P possibly damaging Het
Hs2st1 T G 3: 144,434,691 T290P probably damaging Het
Il5ra G A 6: 106,738,105 L231F probably benign Het
Itgav T A 2: 83,785,461 C529S probably damaging Het
Lrrcc1 A G 3: 14,539,984 D138G possibly damaging Het
Mat1a C T 14: 41,121,894 R357W probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mtss1l T C 8: 110,738,590 V492A possibly damaging Het
Nalcn A G 14: 123,515,359 V330A probably damaging Het
Neu3 A T 7: 99,823,135 probably null Het
Nfx1 A G 4: 40,976,968 D214G possibly damaging Het
Olfr1306 T A 2: 111,912,619 I104F possibly damaging Het
Olfr1390 G A 11: 49,340,894 D121N probably damaging Het
Olfr1457 T C 19: 13,095,343 T102A probably benign Het
Olfr237-ps1 T C 6: 43,153,884 L193P probably damaging Het
Pcdhb14 A T 18: 37,449,296 H485L probably benign Het
Pdss2 A C 10: 43,413,525 K342T possibly damaging Het
Ppargc1a A G 5: 51,490,228 S254P probably damaging Het
Prelid1 A G 13: 55,323,020 D87G probably damaging Het
Prkg1 C A 19: 31,302,309 C190F probably damaging Het
Psmb5 A G 14: 54,614,380 S116P possibly damaging Het
Ripk1 T C 13: 34,027,951 S415P probably damaging Het
Rnft1 A T 11: 86,495,306 K344* probably null Het
Sacs G A 14: 61,192,253 R587Q probably benign Het
Skp2 A T 15: 9,127,884 probably null Het
Spata31d1a T C 13: 59,701,174 K1047E possibly damaging Het
Szt2 G A 4: 118,388,321 T1098I possibly damaging Het
Tcf20 A G 15: 82,855,951 M433T probably benign Het
Tsen54 T C 11: 115,822,584 F438L probably damaging Het
Utp23 C T 15: 51,882,218 T144I probably damaging Het
Vmn2r105 T C 17: 20,234,872 M1V probably null Het
Wdfy4 C T 14: 32,966,399 V2926M probably damaging Het
Zfp407 T C 18: 84,559,896 K1031E probably damaging Het
Other mutations in Rassf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Rassf6 APN 5 90604140 missense probably damaging 1.00
IGL00819:Rassf6 APN 5 90604071 missense probably benign 0.03
IGL01139:Rassf6 APN 5 90608966 makesense probably null
IGL03114:Rassf6 APN 5 90608790 splice site probably benign
R1956:Rassf6 UTSW 5 90615871 nonsense probably null
R2167:Rassf6 UTSW 5 90603938 missense probably damaging 1.00
R2351:Rassf6 UTSW 5 90631559 missense probably benign 0.05
R2877:Rassf6 UTSW 5 90606805 missense probably damaging 1.00
R3943:Rassf6 UTSW 5 90604326 missense possibly damaging 0.49
R3944:Rassf6 UTSW 5 90604326 missense possibly damaging 0.49
R4131:Rassf6 UTSW 5 90609787 missense probably damaging 1.00
R5134:Rassf6 UTSW 5 90604366 critical splice acceptor site probably null
R5153:Rassf6 UTSW 5 90606840 missense possibly damaging 0.81
R5633:Rassf6 UTSW 5 90604118 missense possibly damaging 0.84
R5994:Rassf6 UTSW 5 90617768 missense probably damaging 1.00
R6000:Rassf6 UTSW 5 90603877 missense probably damaging 1.00
R6746:Rassf6 UTSW 5 90609774 missense possibly damaging 0.80
R7038:Rassf6 UTSW 5 90609725 missense probably benign 0.13
R7190:Rassf6 UTSW 5 90606807 missense probably damaging 1.00
R7549:Rassf6 UTSW 5 90606802 missense probably damaging 1.00
R9472:Rassf6 UTSW 5 90617713 nonsense probably null
RF002:Rassf6 UTSW 5 90608921 utr 3 prime probably benign
RF002:Rassf6 UTSW 5 90608925 nonsense probably null
RF004:Rassf6 UTSW 5 90608919 utr 3 prime probably benign
RF011:Rassf6 UTSW 5 90608921 utr 3 prime probably benign
RF013:Rassf6 UTSW 5 90608941 utr 3 prime probably benign
RF018:Rassf6 UTSW 5 90608929 utr 3 prime probably benign
RF032:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608912 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608917 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608923 utr 3 prime probably benign
RF035:Rassf6 UTSW 5 90608908 utr 3 prime probably benign
RF036:Rassf6 UTSW 5 90608915 utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90608924 utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90608930 utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90608915 utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90608932 utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF049:Rassf6 UTSW 5 90608913 utr 3 prime probably benign
RF051:Rassf6 UTSW 5 90608929 utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90608916 utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90608923 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608911 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608924 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608931 utr 3 prime probably benign
RF063:Rassf6 UTSW 5 90608942 nonsense probably null
X0017:Rassf6 UTSW 5 90606789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGCACTGATCTTGTTGG -3'
(R):5'- TTCCTCACACAGATGTAAAGCC -3'

Sequencing Primer
(F):5'- CACAGCACTGATCTTGTTGGTCATAG -3'
(R):5'- TCACACAGATGTAAAGCCTTCTC -3'
Posted On 2021-01-18