Mutagenetix > Incidental Mutation

Incidental Mutation 'R8497:Cadps2'

658316

Institutional Source

Beutler Lab

Gene Symbol

Cadps2

Ensembl Gene

ENSMUSG00000017978

Gene Name

Ca2+-dependent activator protein for secretion 2

Synonyms

Caps2, cpd2, A230044C21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8497 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23262773-23839421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23355919 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 837 (N837D)

Ref Sequence

ENSEMBL: ENSMUSP00000018122 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000018122
AA Change: N837D

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: N837D

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000069074
AA Change: N833D

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: N833D

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	895	5.54e-51	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115358
AA Change: N837D

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: N837D

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115361
AA Change: N830D

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: N830D

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	892	1.9e-49	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125350
AA Change: N475D

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978
AA Change: N475D

Domain	Start	End	E-Value	Type
C2	14	112	1.51e-1	SMART
PH	137	241	2.94e-11	SMART
DUF1041	446	537	1.9e-49	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000142913
AA Change: N808D

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: N808D

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	22	39	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.14e-52	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163871
AA Change: N837D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: N837D

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	7.2e-50	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166458
AA Change: N808D

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: N808D

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.05e-51	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1cf	C	T	19: 31,945,850	H509Y	probably benign	Het
Afm	A	T	5: 90,551,343		probably null	Het
Apc	G	A	18: 34,313,030	C975Y	possibly damaging	Het
Ash1l	G	T	3: 89,007,644	M1860I	probably benign	Het
Bdkrb1	C	T	12: 105,604,204	Q10*	probably null	Het
Bphl	A	G	13: 34,037,723	K21E	possibly damaging	Het
Cat	C	G	2: 103,456,876	A470P	probably damaging	Het
Ccdc129	A	T	6: 55,898,194	R376S	probably benign	Het
Cdc34	G	T	10: 79,685,011	D11Y	probably damaging	Het
Cep290	A	G	10: 100,551,458	E1936G	probably damaging	Het
Cnot6	A	T	11: 49,675,364	N501K	possibly damaging	Het
Cyth3	A	C	5: 143,692,573	D44A	probably benign	Het
Dchs1	C	T	7: 105,758,961	G1888D	probably damaging	Het
Fam160a2	G	T	7: 105,381,189	D820E	probably damaging	Het
Ffar1	T	G	7: 30,860,909	I188L	probably benign	Het
Gm10696	T	A	3: 94,175,812	I231F	possibly damaging	Het
Gpr17	A	G	18: 31,947,120	Y297H	probably damaging	Het
H2-M10.5	A	C	17: 36,773,837	E151A	probably damaging	Het
Hmcn1	C	T	1: 150,580,239	R5310K	probably benign	Het
Hmcn2	T	C	2: 31,423,345	L3522P	possibly damaging	Het
Hs2st1	T	G	3: 144,434,691	T290P	probably damaging	Het
Il5ra	G	A	6: 106,738,105	L231F	probably benign	Het
Itgav	T	A	2: 83,785,461	C529S	probably damaging	Het
Lrrcc1	A	G	3: 14,539,984	D138G	possibly damaging	Het
Mat1a	C	T	14: 41,121,894	R357W	probably damaging	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Mtss1l	T	C	8: 110,738,590	V492A	possibly damaging	Het
Nalcn	A	G	14: 123,515,359	V330A	probably damaging	Het
Neu3	A	T	7: 99,823,135		probably null	Het
Nfx1	A	G	4: 40,976,968	D214G	possibly damaging	Het
Olfr1306	T	A	2: 111,912,619	I104F	possibly damaging	Het
Olfr1390	G	A	11: 49,340,894	D121N	probably damaging	Het
Olfr1457	T	C	19: 13,095,343	T102A	probably benign	Het
Olfr237-ps1	T	C	6: 43,153,884	L193P	probably damaging	Het
Pcdhb14	A	T	18: 37,449,296	H485L	probably benign	Het
Pdss2	A	C	10: 43,413,525	K342T	possibly damaging	Het
Ppargc1a	A	G	5: 51,490,228	S254P	probably damaging	Het
Prelid1	A	G	13: 55,323,020	D87G	probably damaging	Het
Prkg1	C	A	19: 31,302,309	C190F	probably damaging	Het
Psmb5	A	G	14: 54,614,380	S116P	possibly damaging	Het
Rassf6	A	G	5: 90,631,532	V14A	possibly damaging	Het
Ripk1	T	C	13: 34,027,951	S415P	probably damaging	Het
Rnft1	A	T	11: 86,495,306	K344*	probably null	Het
Sacs	G	A	14: 61,192,253	R587Q	probably benign	Het
Skp2	A	T	15: 9,127,884		probably null	Het
Spata31d1a	T	C	13: 59,701,174	K1047E	possibly damaging	Het
Szt2	G	A	4: 118,388,321	T1098I	possibly damaging	Het
Tcf20	A	G	15: 82,855,951	M433T	probably benign	Het
Tsen54	T	C	11: 115,822,584	F438L	probably damaging	Het
Utp23	C	T	15: 51,882,218	T144I	probably damaging	Het
Vmn2r105	T	C	17: 20,234,872	M1V	probably null	Het
Wdfy4	C	T	14: 32,966,399	V2926M	probably damaging	Het
Zfp407	T	C	18: 84,559,896	K1031E	probably damaging	Het

Other mutations in Cadps2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Cadps2	APN	6	23496874	missense	possibly damaging	0.84
IGL01105:Cadps2	APN	6	23321700	splice site	probably benign
IGL01317:Cadps2	APN	6	23314173	missense	possibly damaging	0.76
IGL01409:Cadps2	APN	6	23587441	missense	probably damaging	1.00
IGL01477:Cadps2	APN	6	23263673	missense	probably damaging	1.00
IGL01620:Cadps2	APN	6	23587462	missense	probably benign	0.19
IGL01674:Cadps2	APN	6	23355852	missense	probably damaging	1.00
IGL01675:Cadps2	APN	6	23382905	missense	probably damaging	1.00
IGL01895:Cadps2	APN	6	23427275	missense	probably damaging	0.98
IGL02095:Cadps2	APN	6	23427310	missense	probably benign	0.01
IGL02200:Cadps2	APN	6	23385528	missense	probably damaging	1.00
IGL02380:Cadps2	APN	6	23287732	missense	probably benign	0.11
IGL02680:Cadps2	APN	6	23838896	missense	probably damaging	0.99
IGL02814:Cadps2	APN	6	23321707	missense	probably damaging	1.00
IGL02940:Cadps2	APN	6	23496809	missense	probably benign	0.08
IGL03061:Cadps2	APN	6	23287660	splice site	probably null
IGL03233:Cadps2	APN	6	23263601	missense	probably benign	0.10
R0193:Cadps2	UTSW	6	23599440	missense	probably benign	0.00
R0389:Cadps2	UTSW	6	23321782	missense	possibly damaging	0.88
R0571:Cadps2	UTSW	6	23583412	missense	probably damaging	1.00
R0595:Cadps2	UTSW	6	23321704	critical splice donor site	probably null
R0620:Cadps2	UTSW	6	23583396	missense	probably damaging	1.00
R0723:Cadps2	UTSW	6	23287698	missense	probably damaging	0.99
R0831:Cadps2	UTSW	6	23321740	missense	possibly damaging	0.88
R0836:Cadps2	UTSW	6	23328776	splice site	probably benign
R0942:Cadps2	UTSW	6	23263562	missense	probably damaging	1.00
R1099:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R1120:Cadps2	UTSW	6	23838794	missense	probably damaging	1.00
R1216:Cadps2	UTSW	6	23583473	splice site	probably benign
R1575:Cadps2	UTSW	6	23429218	missense	probably damaging	1.00
R1780:Cadps2	UTSW	6	23320932	critical splice donor site	probably null
R1924:Cadps2	UTSW	6	23688858	missense	probably damaging	0.99
R1944:Cadps2	UTSW	6	23599480	missense	probably damaging	0.99
R1956:Cadps2	UTSW	6	23287686	missense	probably damaging	1.00
R1986:Cadps2	UTSW	6	23323380	missense	probably damaging	1.00
R2045:Cadps2	UTSW	6	23839122	missense	possibly damaging	0.73
R2146:Cadps2	UTSW	6	23838999	intron	probably benign
R2147:Cadps2	UTSW	6	23838999	intron	probably benign
R2148:Cadps2	UTSW	6	23838999	intron	probably benign
R2150:Cadps2	UTSW	6	23838999	intron	probably benign
R2219:Cadps2	UTSW	6	23410832	missense	probably damaging	1.00
R2264:Cadps2	UTSW	6	23323340	missense	probably benign	0.15
R2338:Cadps2	UTSW	6	23838978	splice site	probably benign
R3861:Cadps2	UTSW	6	23355861	missense	probably damaging	1.00
R3898:Cadps2	UTSW	6	23528126	missense	probably damaging	1.00
R3982:Cadps2	UTSW	6	23263531	utr 3 prime	probably benign
R4213:Cadps2	UTSW	6	23599463	missense	probably damaging	1.00
R4384:Cadps2	UTSW	6	23412988	missense	probably benign	0.18
R4432:Cadps2	UTSW	6	23626738	missense	probably damaging	0.99
R4609:Cadps2	UTSW	6	23587579	missense	probably damaging	1.00
R4806:Cadps2	UTSW	6	23688860	missense	probably damaging	0.96
R4977:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R5174:Cadps2	UTSW	6	23287743	missense	probably damaging	1.00
R5267:Cadps2	UTSW	6	23626668	missense	possibly damaging	0.79
R5389:Cadps2	UTSW	6	23329104	missense	probably damaging	1.00
R5737:Cadps2	UTSW	6	23328805	missense	probably benign	0.28
R6074:Cadps2	UTSW	6	23626671	missense	probably damaging	1.00
R6254:Cadps2	UTSW	6	23329163	critical splice acceptor site	probably null
R6323:Cadps2	UTSW	6	23263578	missense	probably benign	0.04
R6463:Cadps2	UTSW	6	23323334	nonsense	probably null
R6907:Cadps2	UTSW	6	23599506	missense	probably damaging	1.00
R6940:Cadps2	UTSW	6	23302492	missense	probably damaging	1.00
R6964:Cadps2	UTSW	6	23583459	missense	probably damaging	1.00
R7079:Cadps2	UTSW	6	23323409	missense	probably damaging	1.00
R7139:Cadps2	UTSW	6	23410889	missense	probably damaging	1.00
R7156:Cadps2	UTSW	6	23688956	missense	probably benign	0.02
R7184:Cadps2	UTSW	6	23583429	missense	probably benign	0.18
R7325:Cadps2	UTSW	6	23409935	missense	unknown
R7526:Cadps2	UTSW	6	23496851	missense	probably damaging	1.00
R7546:Cadps2	UTSW	6	23626608	missense	probably benign	0.15
R7772:Cadps2	UTSW	6	23390446	missense	probably benign	0.00
R7870:Cadps2	UTSW	6	23263642	missense	probably benign	0.14
R8040:Cadps2	UTSW	6	23412943	splice site	probably benign
R8048:Cadps2	UTSW	6	23838863	missense	probably benign	0.14
R8082:Cadps2	UTSW	6	23323314	missense	probably damaging	1.00
R8100:Cadps2	UTSW	6	23838809	missense	probably damaging	1.00
R8115:Cadps2	UTSW	6	23328898	missense	probably benign	0.00
R8768:Cadps2	UTSW	6	23382939	missense	probably damaging	1.00
R8783:Cadps2	UTSW	6	23302304	missense	possibly damaging	0.57
R8804:Cadps2	UTSW	6	23496806	missense	probably damaging	1.00
R8832:Cadps2	UTSW	6	23587537	missense	possibly damaging	0.52
R8848:Cadps2	UTSW	6	23344257	missense	probably damaging	1.00
R8854:Cadps2	UTSW	6	23385508	missense	probably damaging	1.00
R8896:Cadps2	UTSW	6	23410877	missense	probably damaging	1.00
R8910:Cadps2	UTSW	6	23344224	missense	probably benign	0.11
R8921:Cadps2	UTSW	6	23302301	missense	probably benign	0.00
R9228:Cadps2	UTSW	6	23688928	missense	probably benign	0.00
R9297:Cadps2	UTSW	6	23496888	missense	probably benign
R9318:Cadps2	UTSW	6	23496888	missense	probably benign
R9348:Cadps2	UTSW	6	23344263	missense	probably benign	0.20
R9447:Cadps2	UTSW	6	23323298	missense	probably damaging	0.96
R9484:Cadps2	UTSW	6	23626647	missense	probably benign	0.02
R9492:Cadps2	UTSW	6	23427239	missense	probably benign
R9630:Cadps2	UTSW	6	23587572	missense	probably benign	0.08
R9729:Cadps2	UTSW	6	23382983	missense	probably benign	0.28
Z1176:Cadps2	UTSW	6	23321801	missense	probably benign	0.24
Z1177:Cadps2	UTSW	6	23385478	missense	possibly damaging	0.88
Z1177:Cadps2	UTSW	6	23626695	missense	probably damaging	1.00
Z1177:Cadps2	UTSW	6	23838818	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTTTGGCCAGCTACATACTG -3'
(R):5'- TTCTGCAATCTGGTGAACTGG -3'

Sequencing Primer
(F):5'- TTGGCCAGCTACATACTGAGACTC -3'
(R):5'- AGGACATGTCTGGCTTTG -3'

Posted On

2021-01-18