Incidental Mutation 'R8497:Dchs1'
ID 658322
Institutional Source Beutler Lab
Gene Symbol Dchs1
Ensembl Gene ENSMUSG00000036862
Gene Name dachsous cadherin related 1
Synonyms C130033F22Rik, 3110041P15Rik
MMRRC Submission 067939-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8497 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 105402197-105436861 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 105408168 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 1888 (G1888D)
Ref Sequence ENSEMBL: ENSMUSP00000077574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078482]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000078482
AA Change: G1888D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: G1888D

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CA 58 135 5.2e-11 SMART
CA 159 247 6.1e-17 SMART
CA 271 354 2.6e-30 SMART
CA 382 464 7.8e-26 SMART
CA 489 570 1.2e-34 SMART
CA 594 677 1.9e-27 SMART
CA 701 782 5.3e-11 SMART
CA 806 886 1e-12 SMART
CA 910 990 3.3e-14 SMART
CA 1016 1097 3.6e-18 SMART
CA 1121 1203 3.1e-34 SMART
CA 1233 1307 8.8e-16 SMART
low complexity region 1323 1335 N/A INTRINSIC
CA 1344 1427 9.9e-9 SMART
CA 1451 1537 1.5e-23 SMART
CA 1560 1640 7.2e-32 SMART
CA 1664 1742 1.8e-31 SMART
CA 1765 1846 7.8e-30 SMART
CA 1870 1951 3.7e-26 SMART
low complexity region 1957 1965 N/A INTRINSIC
CA 1979 2059 1.1e-6 SMART
CA 2083 2162 2.7e-18 SMART
CA 2186 2268 2.2e-26 SMART
CA 2291 2367 1e-18 SMART
CA 2391 2473 1.8e-23 SMART
CA 2497 2593 3.5e-21 SMART
CA 2617 2697 1.2e-25 SMART
CA 2721 2804 1.9e-18 SMART
CA 2828 2919 3e-3 SMART
transmembrane domain 2932 2954 N/A INTRINSIC
low complexity region 3001 3017 N/A INTRINSIC
low complexity region 3046 3055 N/A INTRINSIC
low complexity region 3088 3097 N/A INTRINSIC
low complexity region 3185 3196 N/A INTRINSIC
low complexity region 3237 3259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140959
Meta Mutation Damage Score 0.1172 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,923,250 (GRCm39) H509Y probably benign Het
Afm A T 5: 90,699,202 (GRCm39) probably null Het
Apc G A 18: 34,446,083 (GRCm39) C975Y possibly damaging Het
Ash1l G T 3: 88,914,951 (GRCm39) M1860I probably benign Het
Bdkrb1 C T 12: 105,570,463 (GRCm39) Q10* probably null Het
Bphl A G 13: 34,221,706 (GRCm39) K21E possibly damaging Het
Cadps2 T C 6: 23,355,918 (GRCm39) N837D probably benign Het
Cat C G 2: 103,287,221 (GRCm39) A470P probably damaging Het
Cdc34 G T 10: 79,520,845 (GRCm39) D11Y probably damaging Het
Cep290 A G 10: 100,387,320 (GRCm39) E1936G probably damaging Het
Cnot6 A T 11: 49,566,191 (GRCm39) N501K possibly damaging Het
Cyth3 A C 5: 143,678,328 (GRCm39) D44A probably benign Het
Ffar1 T G 7: 30,560,334 (GRCm39) I188L probably benign Het
Fhip1b G T 7: 105,030,396 (GRCm39) D820E probably damaging Het
Gpr17 A G 18: 32,080,173 (GRCm39) Y297H probably damaging Het
H2-M10.5 A C 17: 37,084,729 (GRCm39) E151A probably damaging Het
Hmcn1 C T 1: 150,455,990 (GRCm39) R5310K probably benign Het
Hmcn2 T C 2: 31,313,357 (GRCm39) L3522P possibly damaging Het
Hs2st1 T G 3: 144,140,452 (GRCm39) T290P probably damaging Het
Il5ra G A 6: 106,715,066 (GRCm39) L231F probably benign Het
Itgav T A 2: 83,615,805 (GRCm39) C529S probably damaging Het
Itprid1 A T 6: 55,875,179 (GRCm39) R376S probably benign Het
Lrrcc1 A G 3: 14,605,044 (GRCm39) D138G possibly damaging Het
Mat1a C T 14: 40,843,851 (GRCm39) R357W probably damaging Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mtss2 T C 8: 111,465,222 (GRCm39) V492A possibly damaging Het
Nalcn A G 14: 123,752,771 (GRCm39) V330A probably damaging Het
Neu3 A T 7: 99,472,342 (GRCm39) probably null Het
Nfx1 A G 4: 40,976,968 (GRCm39) D214G possibly damaging Het
Or2a14 T C 6: 43,130,818 (GRCm39) L193P probably damaging Het
Or2y17 G A 11: 49,231,721 (GRCm39) D121N probably damaging Het
Or4f14 T A 2: 111,742,964 (GRCm39) I104F possibly damaging Het
Or5b104 T C 19: 13,072,707 (GRCm39) T102A probably benign Het
Pcdhb14 A T 18: 37,582,349 (GRCm39) H485L probably benign Het
Pdss2 A C 10: 43,289,521 (GRCm39) K342T possibly damaging Het
Ppargc1a A G 5: 51,647,570 (GRCm39) S254P probably damaging Het
Prelid1 A G 13: 55,470,833 (GRCm39) D87G probably damaging Het
Prkg1 C A 19: 31,279,709 (GRCm39) C190F probably damaging Het
Psmb5 A G 14: 54,851,837 (GRCm39) S116P possibly damaging Het
Rassf6 A G 5: 90,779,391 (GRCm39) V14A possibly damaging Het
Ripk1 T C 13: 34,211,934 (GRCm39) S415P probably damaging Het
Rnft1 A T 11: 86,386,132 (GRCm39) K344* probably null Het
Sacs G A 14: 61,429,702 (GRCm39) R587Q probably benign Het
Skp2 A T 15: 9,127,971 (GRCm39) probably null Het
Spata31d1a T C 13: 59,848,988 (GRCm39) K1047E possibly damaging Het
Spopfm2 T A 3: 94,083,119 (GRCm39) I231F possibly damaging Het
Szt2 G A 4: 118,245,518 (GRCm39) T1098I possibly damaging Het
Tcf20 A G 15: 82,740,152 (GRCm39) M433T probably benign Het
Tsen54 T C 11: 115,713,410 (GRCm39) F438L probably damaging Het
Utp23 C T 15: 51,745,614 (GRCm39) T144I probably damaging Het
Vmn2r105 T C 17: 20,455,134 (GRCm39) M1V probably null Het
Wdfy4 C T 14: 32,688,356 (GRCm39) V2926M probably damaging Het
Zfp407 T C 18: 84,578,021 (GRCm39) K1031E probably damaging Het
Other mutations in Dchs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Dchs1 APN 7 105,407,950 (GRCm39) missense probably damaging 1.00
IGL00422:Dchs1 APN 7 105,407,236 (GRCm39) missense possibly damaging 0.88
IGL00427:Dchs1 APN 7 105,407,631 (GRCm39) missense probably damaging 0.98
IGL00469:Dchs1 APN 7 105,404,468 (GRCm39) missense probably damaging 1.00
IGL00470:Dchs1 APN 7 105,407,414 (GRCm39) missense probably damaging 1.00
IGL00534:Dchs1 APN 7 105,407,150 (GRCm39) missense probably benign
IGL01292:Dchs1 APN 7 105,410,098 (GRCm39) missense probably damaging 0.98
IGL01380:Dchs1 APN 7 105,411,418 (GRCm39) missense probably damaging 1.00
IGL01396:Dchs1 APN 7 105,421,490 (GRCm39) missense probably damaging 1.00
IGL01448:Dchs1 APN 7 105,421,134 (GRCm39) missense probably damaging 0.98
IGL01759:Dchs1 APN 7 105,404,509 (GRCm39) missense probably benign 0.00
IGL01829:Dchs1 APN 7 105,404,604 (GRCm39) missense probably damaging 0.99
IGL01946:Dchs1 APN 7 105,408,312 (GRCm39) missense probably damaging 1.00
IGL01955:Dchs1 APN 7 105,406,798 (GRCm39) missense probably benign 0.00
IGL02012:Dchs1 APN 7 105,413,504 (GRCm39) missense probably damaging 0.98
IGL02222:Dchs1 APN 7 105,414,094 (GRCm39) missense probably damaging 1.00
IGL02261:Dchs1 APN 7 105,421,776 (GRCm39) missense probably damaging 1.00
IGL02365:Dchs1 APN 7 105,404,395 (GRCm39) missense probably benign 0.22
IGL02430:Dchs1 APN 7 105,421,178 (GRCm39) missense probably benign 0.34
IGL02500:Dchs1 APN 7 105,405,013 (GRCm39) missense probably benign
IGL02741:Dchs1 APN 7 105,406,530 (GRCm39) missense probably damaging 1.00
IGL02890:Dchs1 APN 7 105,405,698 (GRCm39) missense probably damaging 1.00
IGL03213:Dchs1 APN 7 105,404,279 (GRCm39) missense probably damaging 1.00
G1patch:Dchs1 UTSW 7 105,408,000 (GRCm39) missense probably damaging 0.99
P0026:Dchs1 UTSW 7 105,407,612 (GRCm39) missense probably damaging 0.99
PIT4377001:Dchs1 UTSW 7 105,406,795 (GRCm39) missense probably damaging 1.00
PIT4791001:Dchs1 UTSW 7 105,408,178 (GRCm39) missense probably damaging 1.00
R0013:Dchs1 UTSW 7 105,405,043 (GRCm39) missense possibly damaging 0.90
R0090:Dchs1 UTSW 7 105,405,139 (GRCm39) missense probably benign 0.18
R0091:Dchs1 UTSW 7 105,415,301 (GRCm39) splice site probably benign
R0193:Dchs1 UTSW 7 105,414,190 (GRCm39) missense probably benign 0.40
R0395:Dchs1 UTSW 7 105,407,745 (GRCm39) missense probably damaging 1.00
R0448:Dchs1 UTSW 7 105,415,134 (GRCm39) missense probably benign 0.00
R0480:Dchs1 UTSW 7 105,420,696 (GRCm39) missense probably benign 0.14
R0485:Dchs1 UTSW 7 105,421,934 (GRCm39) missense probably benign 0.00
R0566:Dchs1 UTSW 7 105,408,402 (GRCm39) missense probably benign 0.00
R0571:Dchs1 UTSW 7 105,421,203 (GRCm39) missense probably damaging 1.00
R0573:Dchs1 UTSW 7 105,407,985 (GRCm39) missense probably damaging 0.98
R0577:Dchs1 UTSW 7 105,413,462 (GRCm39) missense possibly damaging 0.78
R0622:Dchs1 UTSW 7 105,412,656 (GRCm39) missense probably damaging 1.00
R0654:Dchs1 UTSW 7 105,421,556 (GRCm39) missense probably damaging 1.00
R0677:Dchs1 UTSW 7 105,414,191 (GRCm39) missense probably damaging 1.00
R1171:Dchs1 UTSW 7 105,406,921 (GRCm39) missense probably benign
R1241:Dchs1 UTSW 7 105,407,385 (GRCm39) missense probably damaging 1.00
R1389:Dchs1 UTSW 7 105,404,778 (GRCm39) missense probably benign 0.40
R1427:Dchs1 UTSW 7 105,415,398 (GRCm39) missense probably benign 0.06
R1458:Dchs1 UTSW 7 105,404,451 (GRCm39) missense probably damaging 1.00
R1513:Dchs1 UTSW 7 105,421,278 (GRCm39) nonsense probably null
R1524:Dchs1 UTSW 7 105,413,732 (GRCm39) missense probably damaging 1.00
R1525:Dchs1 UTSW 7 105,408,138 (GRCm39) missense probably damaging 1.00
R1534:Dchs1 UTSW 7 105,421,247 (GRCm39) missense probably damaging 0.98
R1567:Dchs1 UTSW 7 105,421,068 (GRCm39) missense probably benign 0.01
R1577:Dchs1 UTSW 7 105,415,162 (GRCm39) missense probably damaging 1.00
R1603:Dchs1 UTSW 7 105,411,977 (GRCm39) missense probably benign 0.24
R1676:Dchs1 UTSW 7 105,404,128 (GRCm39) missense probably benign 0.40
R1794:Dchs1 UTSW 7 105,420,927 (GRCm39) missense probably benign 0.02
R1826:Dchs1 UTSW 7 105,406,834 (GRCm39) missense probably damaging 1.00
R1892:Dchs1 UTSW 7 105,413,363 (GRCm39) missense probably benign 0.00
R1924:Dchs1 UTSW 7 105,421,487 (GRCm39) missense possibly damaging 0.81
R1932:Dchs1 UTSW 7 105,415,109 (GRCm39) missense probably damaging 1.00
R1962:Dchs1 UTSW 7 105,413,408 (GRCm39) missense probably damaging 1.00
R1985:Dchs1 UTSW 7 105,421,605 (GRCm39) missense possibly damaging 0.72
R1993:Dchs1 UTSW 7 105,411,755 (GRCm39) missense probably benign 0.00
R2007:Dchs1 UTSW 7 105,404,532 (GRCm39) missense probably damaging 1.00
R2316:Dchs1 UTSW 7 105,413,411 (GRCm39) missense possibly damaging 0.71
R2351:Dchs1 UTSW 7 105,403,301 (GRCm39) missense probably benign
R2474:Dchs1 UTSW 7 105,404,281 (GRCm39) missense probably benign 0.37
R2474:Dchs1 UTSW 7 105,422,045 (GRCm39) missense probably damaging 1.00
R3429:Dchs1 UTSW 7 105,405,711 (GRCm39) missense possibly damaging 0.85
R3430:Dchs1 UTSW 7 105,405,711 (GRCm39) missense possibly damaging 0.85
R3737:Dchs1 UTSW 7 105,411,523 (GRCm39) missense possibly damaging 0.88
R3767:Dchs1 UTSW 7 105,406,292 (GRCm39) missense possibly damaging 0.67
R3874:Dchs1 UTSW 7 105,410,842 (GRCm39) missense probably damaging 1.00
R3883:Dchs1 UTSW 7 105,411,770 (GRCm39) missense probably damaging 1.00
R4105:Dchs1 UTSW 7 105,414,347 (GRCm39) missense probably damaging 1.00
R4209:Dchs1 UTSW 7 105,415,397 (GRCm39) missense probably damaging 0.99
R4329:Dchs1 UTSW 7 105,402,966 (GRCm39) missense probably damaging 1.00
R4516:Dchs1 UTSW 7 105,404,059 (GRCm39) missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105,408,180 (GRCm39) missense probably benign
R4579:Dchs1 UTSW 7 105,403,972 (GRCm39) missense probably damaging 1.00
R4588:Dchs1 UTSW 7 105,405,248 (GRCm39) missense probably benign
R4613:Dchs1 UTSW 7 105,421,931 (GRCm39) missense probably damaging 1.00
R4632:Dchs1 UTSW 7 105,403,562 (GRCm39) missense probably benign 0.02
R4696:Dchs1 UTSW 7 105,413,834 (GRCm39) missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105,414,759 (GRCm39) missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105,404,460 (GRCm39) missense probably damaging 0.98
R4738:Dchs1 UTSW 7 105,407,880 (GRCm39) missense probably damaging 0.96
R4768:Dchs1 UTSW 7 105,420,827 (GRCm39) missense possibly damaging 0.96
R4784:Dchs1 UTSW 7 105,415,133 (GRCm39) missense probably damaging 1.00
R4864:Dchs1 UTSW 7 105,404,460 (GRCm39) missense probably damaging 0.98
R4880:Dchs1 UTSW 7 105,404,937 (GRCm39) missense probably benign 0.00
R4909:Dchs1 UTSW 7 105,415,462 (GRCm39) missense probably damaging 1.00
R5102:Dchs1 UTSW 7 105,421,384 (GRCm39) missense probably benign 0.09
R5109:Dchs1 UTSW 7 105,414,221 (GRCm39) missense probably benign
R5126:Dchs1 UTSW 7 105,402,724 (GRCm39) missense probably damaging 1.00
R5149:Dchs1 UTSW 7 105,404,865 (GRCm39) missense probably damaging 0.98
R5330:Dchs1 UTSW 7 105,403,809 (GRCm39) missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105,421,262 (GRCm39) missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105,407,236 (GRCm39) missense probably damaging 1.00
R5386:Dchs1 UTSW 7 105,407,236 (GRCm39) missense probably damaging 1.00
R5622:Dchs1 UTSW 7 105,404,500 (GRCm39) missense probably benign 0.11
R5623:Dchs1 UTSW 7 105,421,976 (GRCm39) missense probably damaging 1.00
R5708:Dchs1 UTSW 7 105,422,016 (GRCm39) missense probably damaging 1.00
R5718:Dchs1 UTSW 7 105,404,955 (GRCm39) missense probably benign 0.01
R5743:Dchs1 UTSW 7 105,420,803 (GRCm39) missense probably benign
R5759:Dchs1 UTSW 7 105,413,383 (GRCm39) missense probably damaging 0.99
R5772:Dchs1 UTSW 7 105,422,247 (GRCm39) missense probably damaging 1.00
R5860:Dchs1 UTSW 7 105,421,242 (GRCm39) missense probably damaging 1.00
R5916:Dchs1 UTSW 7 105,408,373 (GRCm39) missense probably damaging 1.00
R5965:Dchs1 UTSW 7 105,405,132 (GRCm39) missense probably damaging 1.00
R5997:Dchs1 UTSW 7 105,403,302 (GRCm39) missense probably benign 0.08
R6065:Dchs1 UTSW 7 105,404,628 (GRCm39) missense probably damaging 1.00
R6136:Dchs1 UTSW 7 105,410,132 (GRCm39) missense probably benign
R6137:Dchs1 UTSW 7 105,414,313 (GRCm39) missense probably damaging 0.99
R6324:Dchs1 UTSW 7 105,414,145 (GRCm39) missense probably benign 0.05
R6363:Dchs1 UTSW 7 105,407,679 (GRCm39) missense probably benign 0.12
R6466:Dchs1 UTSW 7 105,413,748 (GRCm39) missense probably benign 0.09
R6544:Dchs1 UTSW 7 105,407,385 (GRCm39) missense probably damaging 1.00
R6572:Dchs1 UTSW 7 105,408,013 (GRCm39) missense possibly damaging 0.94
R6579:Dchs1 UTSW 7 105,412,120 (GRCm39) missense probably benign 0.17
R6632:Dchs1 UTSW 7 105,411,085 (GRCm39) missense probably damaging 1.00
R6725:Dchs1 UTSW 7 105,408,000 (GRCm39) missense probably damaging 0.99
R6789:Dchs1 UTSW 7 105,406,210 (GRCm39) missense possibly damaging 0.61
R6868:Dchs1 UTSW 7 105,412,710 (GRCm39) missense possibly damaging 0.91
R7058:Dchs1 UTSW 7 105,406,228 (GRCm39) missense probably benign
R7064:Dchs1 UTSW 7 105,412,392 (GRCm39) missense probably damaging 0.99
R7076:Dchs1 UTSW 7 105,411,078 (GRCm39) missense probably benign 0.04
R7191:Dchs1 UTSW 7 105,414,646 (GRCm39) missense possibly damaging 0.89
R7298:Dchs1 UTSW 7 105,404,338 (GRCm39) nonsense probably null
R7380:Dchs1 UTSW 7 105,407,835 (GRCm39) missense probably benign 0.35
R7438:Dchs1 UTSW 7 105,404,155 (GRCm39) missense probably benign 0.30
R7496:Dchs1 UTSW 7 105,411,066 (GRCm39) missense probably damaging 1.00
R7534:Dchs1 UTSW 7 105,421,580 (GRCm39) missense probably benign 0.00
R7604:Dchs1 UTSW 7 105,415,189 (GRCm39) missense probably damaging 1.00
R7631:Dchs1 UTSW 7 105,408,445 (GRCm39) missense probably benign
R7821:Dchs1 UTSW 7 105,414,352 (GRCm39) missense probably benign 0.00
R7834:Dchs1 UTSW 7 105,414,774 (GRCm39) missense probably benign 0.39
R7841:Dchs1 UTSW 7 105,412,180 (GRCm39) missense probably benign
R7913:Dchs1 UTSW 7 105,408,435 (GRCm39) missense possibly damaging 0.61
R8041:Dchs1 UTSW 7 105,404,395 (GRCm39) missense probably benign 0.45
R8076:Dchs1 UTSW 7 105,411,189 (GRCm39) missense probably damaging 1.00
R8076:Dchs1 UTSW 7 105,405,128 (GRCm39) missense possibly damaging 0.52
R8087:Dchs1 UTSW 7 105,402,706 (GRCm39) missense probably benign 0.41
R8125:Dchs1 UTSW 7 105,414,089 (GRCm39) missense possibly damaging 0.91
R8223:Dchs1 UTSW 7 105,411,824 (GRCm39) missense possibly damaging 0.81
R8239:Dchs1 UTSW 7 105,414,718 (GRCm39) missense probably benign 0.22
R8476:Dchs1 UTSW 7 105,408,015 (GRCm39) missense probably benign 0.05
R8770:Dchs1 UTSW 7 105,420,945 (GRCm39) missense probably damaging 1.00
R8856:Dchs1 UTSW 7 105,410,064 (GRCm39) missense probably damaging 1.00
R8866:Dchs1 UTSW 7 105,404,597 (GRCm39) missense probably benign 0.00
R8948:Dchs1 UTSW 7 105,408,212 (GRCm39) missense probably benign 0.30
R8950:Dchs1 UTSW 7 105,408,212 (GRCm39) missense probably benign 0.30
R9029:Dchs1 UTSW 7 105,402,919 (GRCm39) missense probably benign 0.13
R9039:Dchs1 UTSW 7 105,405,215 (GRCm39) missense probably benign 0.11
R9081:Dchs1 UTSW 7 105,403,636 (GRCm39) missense probably benign 0.00
R9134:Dchs1 UTSW 7 105,404,910 (GRCm39) missense probably damaging 0.96
R9159:Dchs1 UTSW 7 105,415,126 (GRCm39) missense probably benign
R9162:Dchs1 UTSW 7 105,414,732 (GRCm39) missense probably damaging 1.00
R9169:Dchs1 UTSW 7 105,422,114 (GRCm39) missense probably damaging 1.00
R9262:Dchs1 UTSW 7 105,404,833 (GRCm39) missense probably damaging 1.00
R9292:Dchs1 UTSW 7 105,403,120 (GRCm39) missense probably damaging 1.00
R9325:Dchs1 UTSW 7 105,415,402 (GRCm39) missense possibly damaging 0.51
R9376:Dchs1 UTSW 7 105,414,981 (GRCm39) critical splice donor site probably null
R9392:Dchs1 UTSW 7 105,421,869 (GRCm39) missense probably benign 0.09
R9619:Dchs1 UTSW 7 105,413,662 (GRCm39) missense probably benign 0.07
R9680:Dchs1 UTSW 7 105,411,625 (GRCm39) missense probably damaging 1.00
R9687:Dchs1 UTSW 7 105,407,191 (GRCm39) missense probably damaging 0.99
R9747:Dchs1 UTSW 7 105,412,682 (GRCm39) missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105,406,900 (GRCm39) missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105,407,758 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGATCATTGACGTCACGCACTG -3'
(R):5'- TTCCAGCTGCAGATAGAGGC -3'

Sequencing Primer
(F):5'- ACGCACTGTGATGGTGATTG -3'
(R):5'- AGCCCTCAGTGCCACCTTG -3'
Posted On 2021-01-18