Incidental Mutation 'R8497:Cnot6'
ID658329
Institutional Source Beutler Lab
Gene Symbol Cnot6
Ensembl Gene ENSMUSG00000020362
Gene NameCCR4-NOT transcription complex, subunit 6
SynonymsA230103N10Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R8497 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location49671503-49712723 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49675364 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 501 (N501K)
Ref Sequence ENSEMBL: ENSMUSP00000121239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020624] [ENSMUST00000145353]
Predicted Effect probably benign
Transcript: ENSMUST00000020624
AA Change: N496K

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020624
Gene: ENSMUSG00000020362
AA Change: N496K

DomainStartEndE-ValueType
LRR 50 72 1.41e0 SMART
LRR_TYP 73 95 2.71e-2 SMART
LRR_TYP 96 119 1.67e-2 SMART
Pfam:Exo_endo_phos 187 526 1.9e-23 PFAM
low complexity region 529 542 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000145353
AA Change: N501K

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121239
Gene: ENSMUSG00000020362
AA Change: N501K

DomainStartEndE-ValueType
LRR 50 72 1.41e0 SMART
LRR_TYP 73 95 2.71e-2 SMART
LRR_TYP 96 119 1.67e-2 SMART
Pfam:Exo_endo_phos 192 531 1.9e-23 PFAM
low complexity region 534 547 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic component of the CCR4-NOT core transcriptional regulation complex. The encoded protein has a 3'-5' RNase activity and prefers polyadenylated substrates. The CCR4-NOT complex plays a role in many cellular processes, including miRNA-mediated repression, mRNA degradation, and transcriptional regulation. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,945,850 H509Y probably benign Het
Afm A T 5: 90,551,343 probably null Het
Apc G A 18: 34,313,030 C975Y possibly damaging Het
Ash1l G T 3: 89,007,644 M1860I probably benign Het
Bdkrb1 C T 12: 105,604,204 Q10* probably null Het
Bphl A G 13: 34,037,723 K21E possibly damaging Het
Cadps2 T C 6: 23,355,919 N837D probably benign Het
Cat C G 2: 103,456,876 A470P probably damaging Het
Ccdc129 A T 6: 55,898,194 R376S probably benign Het
Cdc34 G T 10: 79,685,011 D11Y probably damaging Het
Cep290 A G 10: 100,551,458 E1936G probably damaging Het
Cyth3 A C 5: 143,692,573 D44A probably benign Het
Dchs1 C T 7: 105,758,961 G1888D probably damaging Het
Fam160a2 G T 7: 105,381,189 D820E probably damaging Het
Ffar1 T G 7: 30,860,909 I188L probably benign Het
Gm10696 T A 3: 94,175,812 I231F possibly damaging Het
Gpr17 A G 18: 31,947,120 Y297H probably damaging Het
H2-M10.5 A C 17: 36,773,837 E151A probably damaging Het
Hmcn1 C T 1: 150,580,239 R5310K probably benign Het
Hmcn2 T C 2: 31,423,345 L3522P possibly damaging Het
Hs2st1 T G 3: 144,434,691 T290P probably damaging Het
Il5ra G A 6: 106,738,105 L231F probably benign Het
Itgav T A 2: 83,785,461 C529S probably damaging Het
Lrrcc1 A G 3: 14,539,984 D138G possibly damaging Het
Mat1a C T 14: 41,121,894 R357W probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mtss1l T C 8: 110,738,590 V492A possibly damaging Het
Nalcn A G 14: 123,515,359 V330A probably damaging Het
Neu3 A T 7: 99,823,135 probably null Het
Nfx1 A G 4: 40,976,968 D214G possibly damaging Het
Olfr1306 T A 2: 111,912,619 I104F possibly damaging Het
Olfr1390 G A 11: 49,340,894 D121N probably damaging Het
Olfr1457 T C 19: 13,095,343 T102A probably benign Het
Olfr237-ps1 T C 6: 43,153,884 L193P probably damaging Het
Pcdhb14 A T 18: 37,449,296 H485L probably benign Het
Pdss2 A C 10: 43,413,525 K342T possibly damaging Het
Ppargc1a A G 5: 51,490,228 S254P probably damaging Het
Prelid1 A G 13: 55,323,020 D87G probably damaging Het
Prkg1 C A 19: 31,302,309 C190F probably damaging Het
Psmb5 A G 14: 54,614,380 S116P possibly damaging Het
Rassf6 A G 5: 90,631,532 V14A possibly damaging Het
Ripk1 T C 13: 34,027,951 S415P probably damaging Het
Rnft1 A T 11: 86,495,306 K344* probably null Het
Sacs G A 14: 61,192,253 R587Q probably benign Het
Skp2 A T 15: 9,127,884 probably null Het
Spata31d1a T C 13: 59,701,174 K1047E possibly damaging Het
Szt2 G A 4: 118,388,321 T1098I possibly damaging Het
Tcf20 A G 15: 82,855,951 M433T probably benign Het
Tsen54 T C 11: 115,822,584 F438L probably damaging Het
Utp23 C T 15: 51,882,218 T144I probably damaging Het
Vmn2r105 T C 17: 20,234,872 M1V probably null Het
Wdfy4 C T 14: 32,966,399 V2926M probably damaging Het
Zfp407 T C 18: 84,559,896 K1031E probably damaging Het
Other mutations in Cnot6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Cnot6 APN 11 49685266 missense probably benign 0.01
IGL00969:Cnot6 APN 11 49685120 missense probably benign
IGL01655:Cnot6 APN 11 49677304 missense probably damaging 1.00
IGL02074:Cnot6 APN 11 49689243 missense probably benign 0.00
IGL02670:Cnot6 APN 11 49685114 nonsense probably null
R0326:Cnot6 UTSW 11 49677436 missense probably damaging 1.00
R0625:Cnot6 UTSW 11 49683171 missense probably damaging 1.00
R1079:Cnot6 UTSW 11 49685103 missense probably benign 0.01
R3820:Cnot6 UTSW 11 49689172 missense probably benign 0.04
R3821:Cnot6 UTSW 11 49689172 missense probably benign 0.04
R3822:Cnot6 UTSW 11 49689172 missense probably benign 0.04
R4202:Cnot6 UTSW 11 49702636 missense probably damaging 1.00
R4515:Cnot6 UTSW 11 49702536 splice site probably null
R6010:Cnot6 UTSW 11 49683239 nonsense probably null
R6193:Cnot6 UTSW 11 49680023 missense probably benign 0.06
R7149:Cnot6 UTSW 11 49680143 missense probably benign
R7501:Cnot6 UTSW 11 49685332 missense probably benign 0.01
R7556:Cnot6 UTSW 11 49675317 missense probably benign 0.15
R8263:Cnot6 UTSW 11 49682175 missense probably damaging 0.99
R8398:Cnot6 UTSW 11 49702618 missense probably damaging 1.00
R8519:Cnot6 UTSW 11 49685114 missense probably benign
RF003:Cnot6 UTSW 11 49702613 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAAAGTGACTACCTCCTGCCAG -3'
(R):5'- GCAGAATTTGACTCTTTCTGGTTTC -3'

Sequencing Primer
(F):5'- TCCTGCCAGGAAGGTGAATGC -3'
(R):5'- GTGTTGCACATACTGTCGTTTC -3'
Posted On2021-01-18