Incidental Mutation 'R8497:Vmn2r105'
ID658345
Institutional Source Beutler Lab
Gene Symbol Vmn2r105
Ensembl Gene ENSMUSG00000091670
Gene Namevomeronasal 2, receptor 105
SynonymsEG627743
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8497 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location20208230-20234872 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 20234872 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000129762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167382]
Predicted Effect probably null
Transcript: ENSMUST00000167382
AA Change: M1V

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129762
Gene: ENSMUSG00000091670
AA Change: M1V

DomainStartEndE-ValueType
Pfam:ANF_receptor 85 469 6.5e-42 PFAM
Pfam:NCD3G 512 565 3.2e-21 PFAM
Pfam:7tm_3 598 833 2.5e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,945,850 H509Y probably benign Het
Afm A T 5: 90,551,343 probably null Het
Apc G A 18: 34,313,030 C975Y possibly damaging Het
Ash1l G T 3: 89,007,644 M1860I probably benign Het
Bdkrb1 C T 12: 105,604,204 Q10* probably null Het
Bphl A G 13: 34,037,723 K21E possibly damaging Het
Cadps2 T C 6: 23,355,919 N837D probably benign Het
Cat C G 2: 103,456,876 A470P probably damaging Het
Ccdc129 A T 6: 55,898,194 R376S probably benign Het
Cdc34 G T 10: 79,685,011 D11Y probably damaging Het
Cep290 A G 10: 100,551,458 E1936G probably damaging Het
Cnot6 A T 11: 49,675,364 N501K possibly damaging Het
Cyth3 A C 5: 143,692,573 D44A probably benign Het
Dchs1 C T 7: 105,758,961 G1888D probably damaging Het
Fam160a2 G T 7: 105,381,189 D820E probably damaging Het
Ffar1 T G 7: 30,860,909 I188L probably benign Het
Gm10696 T A 3: 94,175,812 I231F possibly damaging Het
Gpr17 A G 18: 31,947,120 Y297H probably damaging Het
H2-M10.5 A C 17: 36,773,837 E151A probably damaging Het
Hmcn1 C T 1: 150,580,239 R5310K probably benign Het
Hmcn2 T C 2: 31,423,345 L3522P possibly damaging Het
Hs2st1 T G 3: 144,434,691 T290P probably damaging Het
Il5ra G A 6: 106,738,105 L231F probably benign Het
Itgav T A 2: 83,785,461 C529S probably damaging Het
Lrrcc1 A G 3: 14,539,984 D138G possibly damaging Het
Mat1a C T 14: 41,121,894 R357W probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mtss1l T C 8: 110,738,590 V492A possibly damaging Het
Nalcn A G 14: 123,515,359 V330A probably damaging Het
Neu3 A T 7: 99,823,135 probably null Het
Nfx1 A G 4: 40,976,968 D214G possibly damaging Het
Olfr1306 T A 2: 111,912,619 I104F possibly damaging Het
Olfr1390 G A 11: 49,340,894 D121N probably damaging Het
Olfr1457 T C 19: 13,095,343 T102A probably benign Het
Olfr237-ps1 T C 6: 43,153,884 L193P probably damaging Het
Pcdhb14 A T 18: 37,449,296 H485L probably benign Het
Pdss2 A C 10: 43,413,525 K342T possibly damaging Het
Ppargc1a A G 5: 51,490,228 S254P probably damaging Het
Prelid1 A G 13: 55,323,020 D87G probably damaging Het
Prkg1 C A 19: 31,302,309 C190F probably damaging Het
Psmb5 A G 14: 54,614,380 S116P possibly damaging Het
Rassf6 A G 5: 90,631,532 V14A possibly damaging Het
Ripk1 T C 13: 34,027,951 S415P probably damaging Het
Rnft1 A T 11: 86,495,306 K344* probably null Het
Sacs G A 14: 61,192,253 R587Q probably benign Het
Skp2 A T 15: 9,127,884 probably null Het
Spata31d1a T C 13: 59,701,174 K1047E possibly damaging Het
Szt2 G A 4: 118,388,321 T1098I possibly damaging Het
Tcf20 A G 15: 82,855,951 M433T probably benign Het
Tsen54 T C 11: 115,822,584 F438L probably damaging Het
Utp23 C T 15: 51,882,218 T144I probably damaging Het
Wdfy4 C T 14: 32,966,399 V2926M probably damaging Het
Zfp407 T C 18: 84,559,896 K1031E probably damaging Het
Other mutations in Vmn2r105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Vmn2r105 APN 17 20228555 missense probably benign 0.01
IGL01909:Vmn2r105 APN 17 20224656 missense probably damaging 1.00
IGL01925:Vmn2r105 APN 17 20208711 missense possibly damaging 0.94
IGL02021:Vmn2r105 APN 17 20227895 missense possibly damaging 0.49
IGL02828:Vmn2r105 APN 17 20209083 missense possibly damaging 0.80
IGL02838:Vmn2r105 APN 17 20227585 missense probably damaging 1.00
IGL03343:Vmn2r105 APN 17 20226369 nonsense probably null
R0096:Vmn2r105 UTSW 17 20227479 missense possibly damaging 0.49
R0096:Vmn2r105 UTSW 17 20227479 missense possibly damaging 0.49
R0212:Vmn2r105 UTSW 17 20208565 missense possibly damaging 0.90
R0268:Vmn2r105 UTSW 17 20208676 missense probably benign 0.18
R0271:Vmn2r105 UTSW 17 20234703 missense probably damaging 0.96
R0613:Vmn2r105 UTSW 17 20208316 missense probably damaging 1.00
R0765:Vmn2r105 UTSW 17 20227711 missense probably benign 0.20
R0765:Vmn2r105 UTSW 17 20227857 missense probably damaging 0.98
R1162:Vmn2r105 UTSW 17 20227711 missense probably benign 0.20
R1263:Vmn2r105 UTSW 17 20208322 missense probably damaging 1.00
R1363:Vmn2r105 UTSW 17 20208670 missense probably benign 0.00
R1464:Vmn2r105 UTSW 17 20228742 splice site probably benign
R2029:Vmn2r105 UTSW 17 20224578 missense probably damaging 0.99
R2420:Vmn2r105 UTSW 17 20227835 missense probably benign 0.15
R2421:Vmn2r105 UTSW 17 20227835 missense probably benign 0.15
R2422:Vmn2r105 UTSW 17 20227835 missense probably benign 0.15
R2570:Vmn2r105 UTSW 17 20227323 missense probably damaging 1.00
R3847:Vmn2r105 UTSW 17 20208690 missense possibly damaging 0.85
R3848:Vmn2r105 UTSW 17 20208690 missense possibly damaging 0.85
R4030:Vmn2r105 UTSW 17 20208754 missense probably damaging 0.99
R4275:Vmn2r105 UTSW 17 20228640 missense probably damaging 1.00
R4551:Vmn2r105 UTSW 17 20226351 missense probably benign
R4801:Vmn2r105 UTSW 17 20227294 missense probably benign 0.00
R4802:Vmn2r105 UTSW 17 20227294 missense probably benign 0.00
R4816:Vmn2r105 UTSW 17 20208691 missense probably benign 0.27
R4929:Vmn2r105 UTSW 17 20228018 missense probably benign 0.44
R5022:Vmn2r105 UTSW 17 20208414 missense probably damaging 0.99
R5475:Vmn2r105 UTSW 17 20234782 missense probably benign
R5576:Vmn2r105 UTSW 17 20224574 critical splice donor site probably null
R5795:Vmn2r105 UTSW 17 20228736 missense probably benign 0.00
R5895:Vmn2r105 UTSW 17 20228667 missense probably benign 0.10
R6017:Vmn2r105 UTSW 17 20208627 missense probably damaging 0.97
R6210:Vmn2r105 UTSW 17 20228496 missense probably damaging 1.00
R6491:Vmn2r105 UTSW 17 20227730 nonsense probably null
R6542:Vmn2r105 UTSW 17 20228541 missense probably benign 0.03
R6729:Vmn2r105 UTSW 17 20208343 missense probably damaging 0.99
R7020:Vmn2r105 UTSW 17 20209074 missense probably damaging 1.00
R7033:Vmn2r105 UTSW 17 20208612 missense probably damaging 0.97
R7488:Vmn2r105 UTSW 17 20208783 missense probably damaging 1.00
R7491:Vmn2r105 UTSW 17 20228565 missense probably benign 0.02
R7555:Vmn2r105 UTSW 17 20227675 missense probably damaging 0.98
R7863:Vmn2r105 UTSW 17 20208675 missense probably benign 0.18
R8137:Vmn2r105 UTSW 17 20234704 missense probably benign 0.02
R8166:Vmn2r105 UTSW 17 20208642 missense probably benign 0.07
R8186:Vmn2r105 UTSW 17 20224618 nonsense probably null
R8214:Vmn2r105 UTSW 17 20228513 missense probably benign 0.02
R8850:Vmn2r105 UTSW 17 20208610 missense probably damaging 1.00
R8880:Vmn2r105 UTSW 17 20208967 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGCACTTACTGTAGGTAATTGTCC -3'
(R):5'- ATATGGGACCTCAGCTGCAG -3'

Sequencing Primer
(F):5'- AGTATGGTAGATATGGGTGTGGAAC -3'
(R):5'- CTCAGCTGCAGCAGTGAGAG -3'
Posted On2021-01-18