Mutagenetix > Incidental Mutation

Incidental Mutation 'R8497:Prkg1'

658352

Institutional Source

Beutler Lab

Gene Symbol

Prkg1

Ensembl Gene

ENSMUSG00000052920

Gene Name

protein kinase, cGMP-dependent, type I

Synonyms

Prkgr1b, Prkg1b

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.516) question?

Stock #

R8497 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30567551-31765033 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 31302309 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 190 (C190F)

Ref Sequence

ENSEMBL: ENSMUSP00000073268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000073581]

AlphaFold

P0C605

Predicted Effect

probably damaging
Transcript: ENSMUST00000065067
AA Change: C175F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920
AA Change: C175F

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
cNMP	103	216	6.37e-27	SMART
cNMP	221	343	1.23e-33	SMART
S_TKc	360	619	5.25e-91	SMART
S_TK_X	620	671	1.55e-10	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000073581
AA Change: C190F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920
AA Change: C190F

Domain	Start	End	E-Value	Type
coiled coil region	10	62	N/A	INTRINSIC
cNMP	118	231	6.37e-27	SMART
cNMP	236	358	1.23e-33	SMART
S_TKc	375	634	5.25e-91	SMART
S_TK_X	635	686	1.55e-10	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammals have three different isoforms of cyclic GMP-dependent protein kinase (Ialpha, Ibeta, and II). These PRKG isoforms act as key mediators of the nitric oxide/cGMP signaling pathway and are important components of many signal transduction processes in diverse cell types. This PRKG1 gene on human chromosome 10 encodes the soluble Ialpha and Ibeta isoforms of PRKG by alternative transcript splicing. A separate gene on human chromosome 4, PRKG2, encodes the membrane-bound PRKG isoform II. The PRKG1 proteins play a central role in regulating cardiovascular and neuronal functions in addition to relaxing smooth muscle tone, preventing platelet aggregation, and modulating cell growth. This gene is most strongly expressed in all types of smooth muscle, platelets, cerebellar Purkinje cells, hippocampal neurons, and the lateral amygdala. Isoforms Ialpha and Ibeta have identical cGMP-binding and catalytic domains but differ in their leucine/isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice exhibit abnormal smooth muscle function and penile erectile deficiency. Conditional disruption in the hippocampus results in impaired LTP. Mice homozygous for a transposon induced allele exhibit postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1cf	C	T	19: 31,945,850	H509Y	probably benign	Het
Afm	A	T	5: 90,551,343		probably null	Het
Apc	G	A	18: 34,313,030	C975Y	possibly damaging	Het
Ash1l	G	T	3: 89,007,644	M1860I	probably benign	Het
Bdkrb1	C	T	12: 105,604,204	Q10*	probably null	Het
Bphl	A	G	13: 34,037,723	K21E	possibly damaging	Het
Cadps2	T	C	6: 23,355,919	N837D	probably benign	Het
Cat	C	G	2: 103,456,876	A470P	probably damaging	Het
Ccdc129	A	T	6: 55,898,194	R376S	probably benign	Het
Cdc34	G	T	10: 79,685,011	D11Y	probably damaging	Het
Cep290	A	G	10: 100,551,458	E1936G	probably damaging	Het
Cnot6	A	T	11: 49,675,364	N501K	possibly damaging	Het
Cyth3	A	C	5: 143,692,573	D44A	probably benign	Het
Dchs1	C	T	7: 105,758,961	G1888D	probably damaging	Het
Fam160a2	G	T	7: 105,381,189	D820E	probably damaging	Het
Ffar1	T	G	7: 30,860,909	I188L	probably benign	Het
Gm10696	T	A	3: 94,175,812	I231F	possibly damaging	Het
Gpr17	A	G	18: 31,947,120	Y297H	probably damaging	Het
H2-M10.5	A	C	17: 36,773,837	E151A	probably damaging	Het
Hmcn1	C	T	1: 150,580,239	R5310K	probably benign	Het
Hmcn2	T	C	2: 31,423,345	L3522P	possibly damaging	Het
Hs2st1	T	G	3: 144,434,691	T290P	probably damaging	Het
Il5ra	G	A	6: 106,738,105	L231F	probably benign	Het
Itgav	T	A	2: 83,785,461	C529S	probably damaging	Het
Lrrcc1	A	G	3: 14,539,984	D138G	possibly damaging	Het
Mat1a	C	T	14: 41,121,894	R357W	probably damaging	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Mtss1l	T	C	8: 110,738,590	V492A	possibly damaging	Het
Nalcn	A	G	14: 123,515,359	V330A	probably damaging	Het
Neu3	A	T	7: 99,823,135		probably null	Het
Nfx1	A	G	4: 40,976,968	D214G	possibly damaging	Het
Olfr1306	T	A	2: 111,912,619	I104F	possibly damaging	Het
Olfr1390	G	A	11: 49,340,894	D121N	probably damaging	Het
Olfr1457	T	C	19: 13,095,343	T102A	probably benign	Het
Olfr237-ps1	T	C	6: 43,153,884	L193P	probably damaging	Het
Pcdhb14	A	T	18: 37,449,296	H485L	probably benign	Het
Pdss2	A	C	10: 43,413,525	K342T	possibly damaging	Het
Ppargc1a	A	G	5: 51,490,228	S254P	probably damaging	Het
Prelid1	A	G	13: 55,323,020	D87G	probably damaging	Het
Psmb5	A	G	14: 54,614,380	S116P	possibly damaging	Het
Rassf6	A	G	5: 90,631,532	V14A	possibly damaging	Het
Ripk1	T	C	13: 34,027,951	S415P	probably damaging	Het
Rnft1	A	T	11: 86,495,306	K344*	probably null	Het
Sacs	G	A	14: 61,192,253	R587Q	probably benign	Het
Skp2	A	T	15: 9,127,884		probably null	Het
Spata31d1a	T	C	13: 59,701,174	K1047E	possibly damaging	Het
Szt2	G	A	4: 118,388,321	T1098I	possibly damaging	Het
Tcf20	A	G	15: 82,855,951	M433T	probably benign	Het
Tsen54	T	C	11: 115,822,584	F438L	probably damaging	Het
Utp23	C	T	15: 51,882,218	T144I	probably damaging	Het
Vmn2r105	T	C	17: 20,234,872	M1V	probably null	Het
Wdfy4	C	T	14: 32,966,399	V2926M	probably damaging	Het
Zfp407	T	C	18: 84,559,896	K1031E	probably damaging	Het

Other mutations in Prkg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Prkg1	APN	19	31302340	missense	probably benign	0.02
IGL00481:Prkg1	APN	19	30571622	missense	probably benign	0.28
IGL00517:Prkg1	APN	19	30894668	missense	probably benign
IGL00782:Prkg1	APN	19	30578753	splice site	probably benign
IGL01070:Prkg1	APN	19	30569343	splice site	probably benign
IGL01106:Prkg1	APN	19	30585278	missense	probably benign	0.05
IGL01783:Prkg1	APN	19	30624689	missense	probably damaging	1.00
IGL02135:Prkg1	APN	19	30993076	missense	probably benign	0.13
IGL02492:Prkg1	APN	19	30724202	missense	probably damaging	1.00
IGL02543:Prkg1	APN	19	30624734	missense	possibly damaging	0.62
IGL02733:Prkg1	APN	19	31302301	missense	probably damaging	1.00
IGL03129:Prkg1	APN	19	30585281	nonsense	probably null
IGL03220:Prkg1	APN	19	30569237	utr 3 prime	probably benign
R0363:Prkg1	UTSW	19	31664196	missense	probably damaging	1.00
R0693:Prkg1	UTSW	19	30594978	missense	probably benign
R1099:Prkg1	UTSW	19	30571612	missense	probably benign
R1464:Prkg1	UTSW	19	30578870	missense	probably damaging	0.99
R1464:Prkg1	UTSW	19	30578870	missense	probably damaging	0.99
R1556:Prkg1	UTSW	19	30624743	missense	probably benign
R1738:Prkg1	UTSW	19	30786922	missense	possibly damaging	0.48
R1974:Prkg1	UTSW	19	31585695	missense	probably damaging	1.00
R2011:Prkg1	UTSW	19	31664142	missense	possibly damaging	0.94
R2207:Prkg1	UTSW	19	30578860	missense	probably damaging	1.00
R2270:Prkg1	UTSW	19	30578631	missense	probably benign	0.27
R3009:Prkg1	UTSW	19	31664112	missense	possibly damaging	0.74
R4078:Prkg1	UTSW	19	31585578	missense	probably damaging	1.00
R4355:Prkg1	UTSW	19	30569229	utr 3 prime	probably benign
R4652:Prkg1	UTSW	19	30595012	missense	probably damaging	1.00
R4669:Prkg1	UTSW	19	31664239	missense	probably damaging	0.98
R4684:Prkg1	UTSW	19	31664179	nonsense	probably null
R4789:Prkg1	UTSW	19	31585645	missense	probably damaging	0.97
R4826:Prkg1	UTSW	19	31764606	missense	possibly damaging	0.93
R4936:Prkg1	UTSW	19	30586375	missense	probably benign	0.37
R5625:Prkg1	UTSW	19	31764762	missense	possibly damaging	0.95
R5819:Prkg1	UTSW	19	31585672	missense	probably benign	0.02
R5855:Prkg1	UTSW	19	30894694	missense	possibly damaging	0.93
R5882:Prkg1	UTSW	19	31585697	missense	probably damaging	1.00
R5965:Prkg1	UTSW	19	30724156	splice site	probably null
R5968:Prkg1	UTSW	19	30592924	missense	probably damaging	1.00
R6310:Prkg1	UTSW	19	30569251	missense	probably damaging	1.00
R6433:Prkg1	UTSW	19	30781346	missense	probably benign	0.21
R6702:Prkg1	UTSW	19	30993084	missense	probably benign	0.00
R6750:Prkg1	UTSW	19	31764561	missense	probably benign	0.41
R6894:Prkg1	UTSW	19	30624774	nonsense	probably null
R7155:Prkg1	UTSW	19	31302301	missense	probably damaging	1.00
R7165:Prkg1	UTSW	19	30585199	missense	probably damaging	1.00
R7238:Prkg1	UTSW	19	30624690	missense	probably damaging	1.00
R7428:Prkg1	UTSW	19	30578835	missense	probably damaging	1.00
R7748:Prkg1	UTSW	19	30993091	missense	possibly damaging	0.90
R7804:Prkg1	UTSW	19	30578632	missense	probably benign	0.00
R7804:Prkg1	UTSW	19	30624770	missense	possibly damaging	0.92
R7893:Prkg1	UTSW	19	30586367	missense	probably damaging	0.99
R8304:Prkg1	UTSW	19	30724184	missense	possibly damaging	0.75
R8676:Prkg1	UTSW	19	31764746	missense	probably damaging	0.98
R9318:Prkg1	UTSW	19	30571638	missense	probably benign	0.09
R9694:Prkg1	UTSW	19	30786971	missense	possibly damaging	0.84
X0011:Prkg1	UTSW	19	30993121	missense	probably damaging	1.00
Z1177:Prkg1	UTSW	19	31302373	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GTACAATAATTAGGCCATGTCAGAG -3'
(R):5'- CAGCTCGTAATGAAGCTGCAG -3'

Sequencing Primer
(F):5'- ATCATCTTAGAGTACGAAGGCC -3'
(R):5'- CTCGTAATGAAGCTGCAGCAAATG -3'

Posted On

2021-01-18