Mutagenetix > Incidental Mutation

Incidental Mutation 'R8498:Prdm2'

658363

Institutional Source

Beutler Lab

Gene Symbol

Prdm2

Ensembl Gene

ENSMUSG00000057637

Gene Name

PR domain containing 2, with ZNF domain

Synonyms

KMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik

MMRRC Submission

067940-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8498 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

143107391-143212995 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 143180897 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 35 (A35V)

Ref Sequence

ENSEMBL: ENSMUSP00000101404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105778] [ENSMUST00000134791] [ENSMUST00000154280]

AlphaFold

A2A7B5

Predicted Effect

probably damaging
Transcript: ENSMUST00000105778
AA Change: A35V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: A35V

Domain	Start	End	E-Value	Type
SET	29	146	2.79e-21	SMART
coiled coil region	254	293	N/A	INTRINSIC
low complexity region	333	346	N/A	INTRINSIC
ZnF_C2H2	356	378	2.95e-3	SMART
ZnF_C2H2	386	408	4.79e-3	SMART
ZnF_C2H2	477	500	4.17e-3	SMART
low complexity region	517	528	N/A	INTRINSIC
low complexity region	653	669	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	726	744	N/A	INTRINSIC
low complexity region	868	877	N/A	INTRINSIC
low complexity region	931	951	N/A	INTRINSIC
low complexity region	954	992	N/A	INTRINSIC
low complexity region	1011	1032	N/A	INTRINSIC
low complexity region	1035	1080	N/A	INTRINSIC
ZnF_C2H2	1126	1148	3.52e-1	SMART
ZnF_C2H2	1154	1177	7.55e-1	SMART
ZnF_C2H2	1183	1206	4.72e-2	SMART
low complexity region	1239	1253	N/A	INTRINSIC
ZnF_C2H2	1324	1344	5.12e1	SMART
low complexity region	1406	1423	N/A	INTRINSIC
ZnF_C2H2	1446	1466	1.86e1	SMART
low complexity region	1475	1507	N/A	INTRINSIC
low complexity region	1551	1568	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000134791
AA Change: A35V

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000116458
Gene: ENSMUSG00000057637
AA Change: A35V

Domain	Start	End	E-Value	Type
SET	29	137	1.35e-19	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000154280
AA Change: A35V

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000117741
Gene: ENSMUSG00000057637
AA Change: A35V

Domain	Start	End	E-Value	Type
SET	29	146	2.79e-21	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110009E18Rik	G	T	1: 120,169,142		probably null	Het
Amigo1	A	G	3: 108,188,435	M417V	probably benign	Het
Celsr1	G	T	15: 85,939,105	Q1701K	probably benign	Het
Cfhr2	G	T	1: 139,813,481	T252K	possibly damaging	Het
Cntnap4	T	A	8: 112,875,579	V1205E	possibly damaging	Het
Ctsb	T	C	14: 63,133,432	I31T	probably benign	Het
Cyp4f13	G	C	17: 32,924,859	P497R	probably damaging	Het
Dna2	A	G	10: 62,973,315	D1062G	probably benign	Het
Dnah7a	A	C	1: 53,617,980	M879R	probably benign	Het
Gcc1	C	A	6: 28,418,030	S768I	probably benign	Het
Gm13128	A	G	4: 144,331,663	D280G	probably benign	Het
Gm16486	T	C	8: 70,709,976	I606T	probably benign	Het
Gm29106	T	C	1: 118,200,488	Y637H	probably damaging	Het
Gm4787	T	C	12: 81,379,066	D106G	probably damaging	Het
Gm527	T	A	12: 64,921,008	V68D	probably damaging	Het
Grm1	A	T	10: 11,079,861	Y226*	probably null	Het
Hkdc1	T	C	10: 62,385,883	R799G	probably benign	Het
Ier2	T	C	8: 84,662,724	I10V	probably damaging	Het
Ifi209	A	G	1: 173,642,503	N219S	probably benign	Het
Krt88	A	G	15: 101,453,525	S138G	probably benign	Het
Lrrc3	T	C	10: 77,900,990	D204G	probably damaging	Het
Mllt6	T	C	11: 97,676,862	I705T	possibly damaging	Het
Mpl	G	A	4: 118,449,010	P278S	probably benign	Het
Nkx3-2	T	C	5: 41,763,646	E100G	probably benign	Het
Olfr1340	A	T	4: 118,726,625	Y126F	possibly damaging	Het
Olfr504	A	T	7: 108,565,626	C56*	probably null	Het
Olfr875	G	A	9: 37,773,264	V202M	probably damaging	Het
Pcdh15	G	A	10: 74,482,142	V992I	probably damaging	Het
Pcdhgc5	A	G	18: 37,820,434	N254D	probably damaging	Het
Pdgfd	A	G	9: 6,288,655	E103G	probably damaging	Het
Ppp2r1b	C	T	9: 50,866,894	R304*	probably null	Het
Psd	T	C	19: 46,324,349	N194S	probably damaging	Het
Rasgef1c	A	T	11: 49,971,421	E379V	probably damaging	Het
Rnf43	A	T	11: 87,727,441	I186F	probably damaging	Het
Ros1	C	T	10: 52,178,951	C85Y	probably damaging	Het
Setd2	T	A	9: 110,549,921	L935I	probably damaging	Het
Slc2a5	A	G	4: 150,126,133	Q46R	probably benign	Het
Ss18l1	A	T	2: 180,058,175	Q276L	probably damaging	Het
Tas2r129	A	T	6: 132,951,852	M251L	probably benign	Het
Thoc1	A	G	18: 9,989,693	E458G	probably benign	Het
Wdr35	T	A	12: 9,008,626	N594K	probably damaging	Het
Zzef1	T	A	11: 72,853,322	C835S	probably damaging	Het

Other mutations in Prdm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Prdm2	APN	4	143133759	missense	probably damaging	0.99
IGL00843:Prdm2	APN	4	143134314	missense	probably damaging	1.00
IGL01419:Prdm2	APN	4	143133648	missense	probably damaging	0.99
IGL01662:Prdm2	APN	4	143133568	missense	possibly damaging	0.73
IGL01892:Prdm2	APN	4	143134404	missense	probably damaging	1.00
IGL02104:Prdm2	APN	4	143133427	missense	probably benign	0.01
IGL02208:Prdm2	APN	4	143135743	missense	probably benign	0.01
IGL02260:Prdm2	APN	4	143134587	missense	probably damaging	1.00
IGL02479:Prdm2	APN	4	143134929	missense	probably damaging	1.00
IGL02943:Prdm2	APN	4	143131972	missense	probably benign
IGL02972:Prdm2	APN	4	143132166	missense	probably benign
IGL03038:Prdm2	APN	4	143134001	missense	probably damaging	1.00
IGL03399:Prdm2	APN	4	143135088	missense	probably benign	0.07
G1patch:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
PIT4677001:Prdm2	UTSW	4	143135078	missense	probably damaging	1.00
R0088:Prdm2	UTSW	4	143134954	missense	possibly damaging	0.86
R0153:Prdm2	UTSW	4	143133768	missense	possibly damaging	0.93
R0320:Prdm2	UTSW	4	143179351	missense	probably damaging	1.00
R0384:Prdm2	UTSW	4	143135688	missense	probably benign	0.01
R0400:Prdm2	UTSW	4	143111670	missense	probably benign
R0658:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R0850:Prdm2	UTSW	4	143132203	missense	possibly damaging	0.53
R1118:Prdm2	UTSW	4	143132383	missense	possibly damaging	0.52
R1355:Prdm2	UTSW	4	143131963	missense	probably benign	0.33
R1519:Prdm2	UTSW	4	143135583	missense	probably damaging	1.00
R1936:Prdm2	UTSW	4	143134462	missense	probably benign	0.00
R1987:Prdm2	UTSW	4	143132509	missense	possibly damaging	0.73
R2006:Prdm2	UTSW	4	143131877	missense	possibly damaging	0.73
R2008:Prdm2	UTSW	4	143134947	missense	probably damaging	1.00
R2030:Prdm2	UTSW	4	143132764	missense	possibly damaging	0.53
R2112:Prdm2	UTSW	4	143131936	missense	probably benign
R2221:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2223:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2426:Prdm2	UTSW	4	143111750	nonsense	probably null
R2430:Prdm2	UTSW	4	143133163	missense	possibly damaging	0.73
R2484:Prdm2	UTSW	4	143135206	missense	probably damaging	1.00
R3735:Prdm2	UTSW	4	143134359	missense	probably damaging	1.00
R3944:Prdm2	UTSW	4	143131815	missense	possibly damaging	0.53
R4209:Prdm2	UTSW	4	143134437	missense	probably damaging	1.00
R4411:Prdm2	UTSW	4	143133670	missense	probably benign	0.18
R4647:Prdm2	UTSW	4	143132955	missense	possibly damaging	0.85
R4898:Prdm2	UTSW	4	143134191	missense	probably damaging	1.00
R5032:Prdm2	UTSW	4	143179367	nonsense	probably null
R5181:Prdm2	UTSW	4	143134966	missense	probably benign	0.35
R5513:Prdm2	UTSW	4	143135893	small deletion	probably benign
R5539:Prdm2	UTSW	4	143132694	missense	possibly damaging	0.53
R5563:Prdm2	UTSW	4	143134630	missense	probably benign	0.09
R5618:Prdm2	UTSW	4	143133537	missense	probably benign	0.00
R5900:Prdm2	UTSW	4	143134720	missense	probably damaging	1.00
R5990:Prdm2	UTSW	4	143170113	missense	probably damaging	1.00
R6148:Prdm2	UTSW	4	143132907	missense	probably benign	0.33
R6166:Prdm2	UTSW	4	143134736	missense	probably damaging	0.99
R6223:Prdm2	UTSW	4	143142207	missense	probably benign	0.41
R6530:Prdm2	UTSW	4	143134047	missense	probably benign	0.05
R6631:Prdm2	UTSW	4	143134884	missense	probably benign	0.05
R6725:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R6847:Prdm2	UTSW	4	143132950	missense	probably benign	0.18
R7193:Prdm2	UTSW	4	143180894	missense	probably damaging	1.00
R7238:Prdm2	UTSW	4	143135821	missense	probably benign	0.35
R7292:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R7417:Prdm2	UTSW	4	143179299	missense	probably damaging	1.00
R7748:Prdm2	UTSW	4	143135889	missense	possibly damaging	0.89
R7885:Prdm2	UTSW	4	143134570	missense	probably benign	0.41
R7936:Prdm2	UTSW	4	143135864	missense	probably damaging	0.99
R7976:Prdm2	UTSW	4	143133242	nonsense	probably null
R8124:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R8150:Prdm2	UTSW	4	143132733	missense	possibly damaging	0.73
R8156:Prdm2	UTSW	4	143134768	missense	probably benign	0.01
R8178:Prdm2	UTSW	4	143132448	missense	probably benign	0.33
R8235:Prdm2	UTSW	4	143132467	nonsense	probably null
R8404:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8502:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8688:Prdm2	UTSW	4	143111740	missense	probably benign
R8732:Prdm2	UTSW	4	143136010	missense	probably benign	0.00
R8796:Prdm2	UTSW	4	143133447	missense	probably benign	0.33
R8874:Prdm2	UTSW	4	143133215	missense	possibly damaging	0.70
R8887:Prdm2	UTSW	4	143134201	missense	probably damaging	1.00
R9119:Prdm2	UTSW	4	143131879	nonsense	probably null
R9139:Prdm2	UTSW	4	143132182	missense	probably benign	0.03
R9165:Prdm2	UTSW	4	143132104	missense	possibly damaging	0.73
R9342:Prdm2	UTSW	4	143134908	missense	probably damaging	1.00
R9518:Prdm2	UTSW	4	143134009	missense	possibly damaging	0.94
R9546:Prdm2	UTSW	4	143134991	missense	probably damaging	1.00
R9547:Prdm2	UTSW	4	143134991	missense	probably damaging	1.00
R9680:Prdm2	UTSW	4	143132509	missense	possibly damaging	0.73
R9730:Prdm2	UTSW	4	143132089	missense	possibly damaging	0.73
X0017:Prdm2	UTSW	4	143134707	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCAAGAGGAAGCTGGTTTC -3'
(R):5'- CCAGGTTCAGTAGAGCAATGC -3'

Sequencing Primer
(F):5'- ACCCTGGATTCTTATGTAGAAAGTGC -3'
(R):5'- TTCAGTAGAGCAATGCAAAGC -3'

Posted On

2021-01-18