Incidental Mutation 'R8498:Krt88'
ID658392
Institutional Source Beutler Lab
Gene Symbol Krt88
Ensembl Gene ENSMUSG00000063971
Gene Namekeratin 88
Synonyms1700011A15Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8498 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location101447744-101453907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101453525 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 138 (S138G)
Ref Sequence ENSEMBL: ENSMUSP00000023781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023781]
Predicted Effect probably benign
Transcript: ENSMUST00000023781
AA Change: S138G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023781
Gene: ENSMUSG00000063971
AA Change: S138G

DomainStartEndE-ValueType
Pfam:Filament 1 109 5e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G T 1: 120,169,142 probably null Het
Amigo1 A G 3: 108,188,435 M417V probably benign Het
Celsr1 G T 15: 85,939,105 Q1701K probably benign Het
Cfhr2 G T 1: 139,813,481 T252K possibly damaging Het
Cntnap4 T A 8: 112,875,579 V1205E possibly damaging Het
Ctsb T C 14: 63,133,432 I31T probably benign Het
Cyp4f13 G C 17: 32,924,859 P497R probably damaging Het
Dna2 A G 10: 62,973,315 D1062G probably benign Het
Dnah7a A C 1: 53,617,980 M879R probably benign Het
Gcc1 C A 6: 28,418,030 S768I probably benign Het
Gm13128 A G 4: 144,331,663 D280G probably benign Het
Gm16486 T C 8: 70,709,976 I606T probably benign Het
Gm29106 T C 1: 118,200,488 Y637H probably damaging Het
Gm4787 T C 12: 81,379,066 D106G probably damaging Het
Gm527 T A 12: 64,921,008 V68D probably damaging Het
Grm1 A T 10: 11,079,861 Y226* probably null Het
Hkdc1 T C 10: 62,385,883 R799G probably benign Het
Ier2 T C 8: 84,662,724 I10V probably damaging Het
Ifi209 A G 1: 173,642,503 N219S probably benign Het
Lrrc3 T C 10: 77,900,990 D204G probably damaging Het
Mllt6 T C 11: 97,676,862 I705T possibly damaging Het
Mpl G A 4: 118,449,010 P278S probably benign Het
Nkx3-2 T C 5: 41,763,646 E100G probably benign Het
Olfr1340 A T 4: 118,726,625 Y126F possibly damaging Het
Olfr504 A T 7: 108,565,626 C56* probably null Het
Olfr875 G A 9: 37,773,264 V202M probably damaging Het
Pcdh15 G A 10: 74,482,142 V992I probably damaging Het
Pcdhgc5 A G 18: 37,820,434 N254D probably damaging Het
Pdgfd A G 9: 6,288,655 E103G probably damaging Het
Ppp2r1b C T 9: 50,866,894 R304* probably null Het
Prdm2 G A 4: 143,180,897 A35V probably damaging Het
Psd T C 19: 46,324,349 N194S probably damaging Het
Rasgef1c A T 11: 49,971,421 E379V probably damaging Het
Rnf43 A T 11: 87,727,441 I186F probably damaging Het
Ros1 C T 10: 52,178,951 C85Y probably damaging Het
Setd2 T A 9: 110,549,921 L935I probably damaging Het
Slc2a5 A G 4: 150,126,133 Q46R probably benign Het
Ss18l1 A T 2: 180,058,175 Q276L probably damaging Het
Tas2r129 A T 6: 132,951,852 M251L probably benign Het
Thoc1 A G 18: 9,989,693 E458G probably benign Het
Wdr35 T A 12: 9,008,626 N594K probably damaging Het
Zzef1 T A 11: 72,853,322 C835S probably damaging Het
Other mutations in Krt88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Krt88 APN 15 101453627 makesense probably null
IGL02238:Krt88 APN 15 101452605 splice site probably benign
R3916:Krt88 UTSW 15 101452928 splice site probably null
R3917:Krt88 UTSW 15 101452928 splice site probably null
R5161:Krt88 UTSW 15 101450468 missense probably benign 0.28
R7253:Krt88 UTSW 15 101450511 missense probably damaging 1.00
R7360:Krt88 UTSW 15 101447762 start gained probably benign
R8163:Krt88 UTSW 15 101453508 missense probably damaging 1.00
R8745:Krt88 UTSW 15 101453579 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCTGAGGAGGGTCTATCTC -3'
(R):5'- TCTAGTTCCAAGTGAGGGGC -3'

Sequencing Primer
(F):5'- AGGAGGGTCTATCTCTCTTGGAG -3'
(R):5'- CTCTGTGGGCAAGGGAATC -3'
Posted On2021-01-18