Incidental Mutation 'R8498:Cyp4f13'
ID658393
Institutional Source Beutler Lab
Gene Symbol Cyp4f13
Ensembl Gene ENSMUSG00000024055
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 13
Synonyms0610030I10Rik, P450 CYP4F13, leukotriene B4 omega hydroxylase
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R8498 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32924688-32947402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 32924859 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 497 (P497R)
Ref Sequence ENSEMBL: ENSMUSP00000074733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075253] [ENSMUST00000137222] [ENSMUST00000139353]
Predicted Effect probably damaging
Transcript: ENSMUST00000075253
AA Change: P497R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074733
Gene: ENSMUSG00000024055
AA Change: P497R

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 52 514 1.9e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137222
SMART Domains Protein: ENSMUSP00000123495
Gene: ENSMUSG00000024055

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SCOP:d1e9xa_ 48 115 1e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139353
AA Change: P388R

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123282
Gene: ENSMUSG00000024055
AA Change: P388R

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 60 405 7.8e-108 PFAM
Meta Mutation Damage Score 0.5716 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP4F3, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. The enzyme starts the process of inactivating and degrading leukotriene B4, a potent mediator of inflammation. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F8, is approximately 18 kb away. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G T 1: 120,169,142 probably null Het
Amigo1 A G 3: 108,188,435 M417V probably benign Het
Celsr1 G T 15: 85,939,105 Q1701K probably benign Het
Cfhr2 G T 1: 139,813,481 T252K possibly damaging Het
Cntnap4 T A 8: 112,875,579 V1205E possibly damaging Het
Ctsb T C 14: 63,133,432 I31T probably benign Het
Dna2 A G 10: 62,973,315 D1062G probably benign Het
Dnah7a A C 1: 53,617,980 M879R probably benign Het
Gcc1 C A 6: 28,418,030 S768I probably benign Het
Gm13128 A G 4: 144,331,663 D280G probably benign Het
Gm16486 T C 8: 70,709,976 I606T probably benign Het
Gm29106 T C 1: 118,200,488 Y637H probably damaging Het
Gm4787 T C 12: 81,379,066 D106G probably damaging Het
Gm527 T A 12: 64,921,008 V68D probably damaging Het
Grm1 A T 10: 11,079,861 Y226* probably null Het
Hkdc1 T C 10: 62,385,883 R799G probably benign Het
Ier2 T C 8: 84,662,724 I10V probably damaging Het
Ifi209 A G 1: 173,642,503 N219S probably benign Het
Krt88 A G 15: 101,453,525 S138G probably benign Het
Lrrc3 T C 10: 77,900,990 D204G probably damaging Het
Mllt6 T C 11: 97,676,862 I705T possibly damaging Het
Mpl G A 4: 118,449,010 P278S probably benign Het
Nkx3-2 T C 5: 41,763,646 E100G probably benign Het
Olfr1340 A T 4: 118,726,625 Y126F possibly damaging Het
Olfr504 A T 7: 108,565,626 C56* probably null Het
Olfr875 G A 9: 37,773,264 V202M probably damaging Het
Pcdh15 G A 10: 74,482,142 V992I probably damaging Het
Pcdhgc5 A G 18: 37,820,434 N254D probably damaging Het
Pdgfd A G 9: 6,288,655 E103G probably damaging Het
Ppp2r1b C T 9: 50,866,894 R304* probably null Het
Prdm2 G A 4: 143,180,897 A35V probably damaging Het
Psd T C 19: 46,324,349 N194S probably damaging Het
Rasgef1c A T 11: 49,971,421 E379V probably damaging Het
Rnf43 A T 11: 87,727,441 I186F probably damaging Het
Ros1 C T 10: 52,178,951 C85Y probably damaging Het
Setd2 T A 9: 110,549,921 L935I probably damaging Het
Slc2a5 A G 4: 150,126,133 Q46R probably benign Het
Ss18l1 A T 2: 180,058,175 Q276L probably damaging Het
Tas2r129 A T 6: 132,951,852 M251L probably benign Het
Thoc1 A G 18: 9,989,693 E458G probably benign Het
Wdr35 T A 12: 9,008,626 N594K probably damaging Het
Zzef1 T A 11: 72,853,322 C835S probably damaging Het
Other mutations in Cyp4f13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Cyp4f13 APN 17 32941164 missense probably benign 0.00
IGL01835:Cyp4f13 APN 17 32930614 missense probably benign 0.39
IGL02234:Cyp4f13 APN 17 32924774 utr 3 prime probably benign
IGL02437:Cyp4f13 APN 17 32930608 missense probably benign 0.12
IGL02465:Cyp4f13 APN 17 32929136 critical splice donor site probably null
IGL02604:Cyp4f13 APN 17 32932421 missense probably benign 0.01
IGL02934:Cyp4f13 APN 17 32929871 missense probably damaging 1.00
IGL03177:Cyp4f13 APN 17 32946914 missense possibly damaging 0.88
R0117:Cyp4f13 UTSW 17 32930606 missense probably damaging 0.98
R0138:Cyp4f13 UTSW 17 32941106 missense possibly damaging 0.63
R0220:Cyp4f13 UTSW 17 32929502 missense probably damaging 1.00
R0243:Cyp4f13 UTSW 17 32924969 splice site probably benign
R0357:Cyp4f13 UTSW 17 32932651 nonsense probably null
R1078:Cyp4f13 UTSW 17 32925568 missense probably damaging 1.00
R1757:Cyp4f13 UTSW 17 32929958 missense probably damaging 1.00
R1990:Cyp4f13 UTSW 17 32925568 missense probably damaging 1.00
R2351:Cyp4f13 UTSW 17 32925596 missense probably benign 0.01
R4704:Cyp4f13 UTSW 17 32925735 missense probably damaging 1.00
R4865:Cyp4f13 UTSW 17 32925704 missense probably damaging 1.00
R5004:Cyp4f13 UTSW 17 32925786 missense probably benign 0.39
R5310:Cyp4f13 UTSW 17 32925821 missense probably damaging 1.00
R5574:Cyp4f13 UTSW 17 32929205 missense probably benign 0.39
R5996:Cyp4f13 UTSW 17 32929473 missense possibly damaging 0.87
R6190:Cyp4f13 UTSW 17 32929873 missense probably damaging 1.00
R8254:Cyp4f13 UTSW 17 32929933 missense probably benign 0.04
R8495:Cyp4f13 UTSW 17 32924859 missense probably damaging 1.00
R8496:Cyp4f13 UTSW 17 32924859 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCATAGTCACTCAAAGAACAGGAG -3'
(R):5'- TAGGCCAGGTCCCAGAAATG -3'

Sequencing Primer
(F):5'- AGAACAGGAGGCAGTTCTGTTTATTC -3'
(R):5'- CAGGTCCCAGAAATGCGGAC -3'
Posted On2021-01-18