Incidental Mutation 'R8499:Card14'
ID658429
Institutional Source Beutler Lab
Gene Symbol Card14
Ensembl Gene ENSMUSG00000013483
Gene Namecaspase recruitment domain family, member 14
SynonymsBimp2, CARMA2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R8499 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location119307768-119345375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119331244 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 455 (L455P)
Ref Sequence ENSEMBL: ENSMUSP00000101857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053245] [ENSMUST00000106250]
Predicted Effect probably benign
Transcript: ENSMUST00000053245
AA Change: L455P

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000053665
Gene: ENSMUSG00000013483
AA Change: L455P

DomainStartEndE-ValueType
Pfam:CARD 20 106 4.1e-25 PFAM
coiled coil region 126 173 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 262 275 N/A INTRINSIC
coiled coil region 280 377 N/A INTRINSIC
low complexity region 438 450 N/A INTRINSIC
low complexity region 473 483 N/A INTRINSIC
low complexity region 541 551 N/A INTRINSIC
PDZ 578 657 5.51e-3 SMART
Blast:SH3 676 735 4e-25 BLAST
low complexity region 736 746 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Blast:GuKc 826 989 4e-63 BLAST
SCOP:d1kjwa2 855 994 2e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106250
AA Change: L455P

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101857
Gene: ENSMUSG00000013483
AA Change: L455P

DomainStartEndE-ValueType
Pfam:CARD 20 106 2.8e-25 PFAM
coiled coil region 126 173 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 262 275 N/A INTRINSIC
coiled coil region 280 377 N/A INTRINSIC
low complexity region 438 450 N/A INTRINSIC
low complexity region 473 483 N/A INTRINSIC
low complexity region 541 551 N/A INTRINSIC
PDZ 578 657 5.51e-3 SMART
Blast:SH3 676 735 4e-25 BLAST
low complexity region 736 746 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Blast:GuKc 826 989 4e-63 BLAST
SCOP:d1kjwa2 855 994 2e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a caspase recruitment domain-containing protein that is a member of the membrane-associated guanylate kinase (MAGUK) family of proteins. Members of this protein family are scaffold proteins that are involved in a diverse array of cellular processes including cellular adhesion, signal transduction and cell polarity control. This protein has been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 40,755,152 D485G probably damaging Het
Ap4b1 G A 3: 103,820,702 R344Q probably damaging Het
Apol7c G T 15: 77,526,080 P222Q possibly damaging Het
Atf6b T C 17: 34,650,822 L272P probably damaging Het
Atp11b G T 3: 35,810,705 R559I probably benign Het
Bhmt T A 13: 93,620,092 I343F probably benign Het
Btbd7 A T 12: 102,788,372 F712I probably damaging Het
Cast A T 13: 74,798,716 H26Q probably benign Het
Clcn1 A G 6: 42,307,199 N567S probably damaging Het
Cnot6l A T 5: 96,077,317 W506R probably damaging Het
Dynap T A 18: 70,240,973 I161L unknown Het
Eif4g3 A C 4: 138,165,928 T996P probably damaging Het
Exoc8 A G 8: 124,897,110 Y173H probably benign Het
Fbll1 C T 11: 35,798,080 V119M probably damaging Het
Fbxw22 A T 9: 109,385,000 F249L probably benign Het
Fxyd1 C A 7: 31,053,104 probably benign Het
Gm10130 T C 2: 150,362,987 S74P probably benign Het
Grhl3 C A 4: 135,549,238 probably null Het
Grk4 A G 5: 34,745,346 E414G possibly damaging Het
H2-Q5 A G 17: 35,394,844 D123G Het
H2-Q5 C T 17: 35,394,969 R165* probably null Het
Hgf A T 5: 16,566,856 E160D probably damaging Het
Hist1h2bg T A 13: 23,571,706 S92T probably benign Het
Ifi211 T C 1: 173,905,520 I192V probably benign Het
Klk1b22 T C 7: 44,112,720 F7L probably benign Het
Lcmt1 C A 7: 123,430,148 T331N probably benign Het
Lrrc36 A T 8: 105,449,536 T181S possibly damaging Het
Ltbp3 T A 19: 5,748,684 S520T probably benign Het
Nacc1 A T 8: 84,676,716 C177S probably damaging Het
Nedd4l T A 18: 65,209,657 V888E probably damaging Het
Oc90 C T 15: 65,881,556 G305S probably damaging Het
Olfr556 T A 7: 102,670,805 I295N probably damaging Het
Olfr559 A G 7: 102,723,725 V255A probably damaging Het
Pappa2 T A 1: 158,936,522 D473V probably damaging Het
Pou2f2 C A 7: 25,100,198 G117C probably damaging Het
Prkci A G 3: 31,025,217 H68R probably damaging Het
Pygm A G 19: 6,390,362 K479E probably damaging Het
Qpct A G 17: 79,077,567 D212G probably damaging Het
Sh3glb2 A T 2: 30,359,204 M1K probably null Het
Slc22a5 A G 11: 53,867,643 S444P probably damaging Het
Snai3 G A 8: 122,456,405 H134Y probably benign Het
Synpo T C 18: 60,602,972 D395G probably damaging Het
Tmem63c C T 12: 87,072,964 T344I probably damaging Het
Tnfsf14 A G 17: 57,190,534 Y233H Het
Ttn A G 2: 76,918,991 F3905L probably benign Het
Tubgcp5 T A 7: 55,804,615 H219Q possibly damaging Het
Usp16 C T 16: 87,474,648 T364M possibly damaging Het
Vmn1r59 C T 7: 5,454,751 M3I probably benign Het
Vmn2r61 T A 7: 42,300,276 C707S probably damaging Het
Vps13b T C 15: 35,841,320 S2499P probably damaging Het
Ythdf3 A G 3: 16,205,015 E442G possibly damaging Het
Other mutations in Card14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Card14 APN 11 119343145 missense probably benign 0.10
IGL02070:Card14 APN 11 119344704 missense probably damaging 1.00
IGL02632:Card14 APN 11 119338904 missense probably benign 0.02
R0183:Card14 UTSW 11 119326698 missense probably damaging 1.00
R0614:Card14 UTSW 11 119322827 missense probably benign
R0766:Card14 UTSW 11 119324176 missense probably damaging 1.00
R1033:Card14 UTSW 11 119338370 missense probably damaging 1.00
R1705:Card14 UTSW 11 119338406 missense possibly damaging 0.77
R1907:Card14 UTSW 11 119331259 missense probably benign 0.00
R1992:Card14 UTSW 11 119321821 critical splice acceptor site probably null
R3729:Card14 UTSW 11 119333932 missense probably damaging 1.00
R4472:Card14 UTSW 11 119333958 missense possibly damaging 0.77
R4578:Card14 UTSW 11 119326741 missense probably benign 0.20
R4763:Card14 UTSW 11 119343175 missense probably damaging 0.99
R5117:Card14 UTSW 11 119338250 missense probably damaging 0.99
R5386:Card14 UTSW 11 119317289 missense probably damaging 1.00
R6457:Card14 UTSW 11 119339602 nonsense probably null
R6622:Card14 UTSW 11 119333988 missense probably benign 0.06
R6998:Card14 UTSW 11 119322899 missense probably damaging 1.00
R7269:Card14 UTSW 11 119337747 missense probably damaging 1.00
R7304:Card14 UTSW 11 119337747 missense probably damaging 1.00
R7310:Card14 UTSW 11 119326179 missense probably null 1.00
R7612:Card14 UTSW 11 119333579 missense possibly damaging 0.52
R7689:Card14 UTSW 11 119325502 missense possibly damaging 0.66
R8181:Card14 UTSW 11 119321892 missense probably damaging 1.00
R8188:Card14 UTSW 11 119337797 missense probably damaging 1.00
R8493:Card14 UTSW 11 119333609 critical splice donor site probably null
Z1177:Card14 UTSW 11 119341061 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTCAGTAACTCCCTTTCCCAG -3'
(R):5'- GGAAGCTAGCTCATACCCAG -3'

Sequencing Primer
(F):5'- GGGTCTCATTGCTTTATATGCAAAG -3'
(R):5'- CAGATCGTCCTTGCAAGCTG -3'
Posted On2021-01-18