Incidental Mutation 'R8499:Apol7c'
ID658437
Institutional Source Beutler Lab
Gene Symbol Apol7c
Ensembl Gene ENSMUSG00000044309
Gene Nameapolipoprotein L 7c
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R8499 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location77524852-77533316 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 77526080 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 222 (P222Q)
Ref Sequence ENSEMBL: ENSMUSP00000050745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062562] [ENSMUST00000230863]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062562
AA Change: P222Q

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050745
Gene: ENSMUSG00000044309
AA Change: P222Q

DomainStartEndE-ValueType
Pfam:ApoL 20 81 1.7e-12 PFAM
Pfam:ApoL 77 367 5.1e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230863
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 40,755,152 D485G probably damaging Het
Ap4b1 G A 3: 103,820,702 R344Q probably damaging Het
Atf6b T C 17: 34,650,822 L272P probably damaging Het
Atp11b G T 3: 35,810,705 R559I probably benign Het
Bhmt T A 13: 93,620,092 I343F probably benign Het
Btbd7 A T 12: 102,788,372 F712I probably damaging Het
Card14 T C 11: 119,331,244 L455P probably benign Het
Cast A T 13: 74,798,716 H26Q probably benign Het
Clcn1 A G 6: 42,307,199 N567S probably damaging Het
Cnot6l A T 5: 96,077,317 W506R probably damaging Het
Dynap T A 18: 70,240,973 I161L unknown Het
Eif4g3 A C 4: 138,165,928 T996P probably damaging Het
Exoc8 A G 8: 124,897,110 Y173H probably benign Het
Fbll1 C T 11: 35,798,080 V119M probably damaging Het
Fbxw22 A T 9: 109,385,000 F249L probably benign Het
Fxyd1 C A 7: 31,053,104 probably benign Het
Gm10130 T C 2: 150,362,987 S74P probably benign Het
Grhl3 C A 4: 135,549,238 probably null Het
Grk4 A G 5: 34,745,346 E414G possibly damaging Het
H2-Q5 A G 17: 35,394,844 D123G Het
H2-Q5 C T 17: 35,394,969 R165* probably null Het
Hgf A T 5: 16,566,856 E160D probably damaging Het
Hist1h2bg T A 13: 23,571,706 S92T probably benign Het
Ifi211 T C 1: 173,905,520 I192V probably benign Het
Klk1b22 T C 7: 44,112,720 F7L probably benign Het
Lcmt1 C A 7: 123,430,148 T331N probably benign Het
Lrrc36 A T 8: 105,449,536 T181S possibly damaging Het
Ltbp3 T A 19: 5,748,684 S520T probably benign Het
Nacc1 A T 8: 84,676,716 C177S probably damaging Het
Nedd4l T A 18: 65,209,657 V888E probably damaging Het
Oc90 C T 15: 65,881,556 G305S probably damaging Het
Olfr556 T A 7: 102,670,805 I295N probably damaging Het
Olfr559 A G 7: 102,723,725 V255A probably damaging Het
Pappa2 T A 1: 158,936,522 D473V probably damaging Het
Pou2f2 C A 7: 25,100,198 G117C probably damaging Het
Prkci A G 3: 31,025,217 H68R probably damaging Het
Pygm A G 19: 6,390,362 K479E probably damaging Het
Qpct A G 17: 79,077,567 D212G probably damaging Het
Sh3glb2 A T 2: 30,359,204 M1K probably null Het
Slc22a5 A G 11: 53,867,643 S444P probably damaging Het
Snai3 G A 8: 122,456,405 H134Y probably benign Het
Synpo T C 18: 60,602,972 D395G probably damaging Het
Tmem63c C T 12: 87,072,964 T344I probably damaging Het
Tnfsf14 A G 17: 57,190,534 Y233H Het
Ttn A G 2: 76,918,991 F3905L probably benign Het
Tubgcp5 T A 7: 55,804,615 H219Q possibly damaging Het
Usp16 C T 16: 87,474,648 T364M possibly damaging Het
Vmn1r59 C T 7: 5,454,751 M3I probably benign Het
Vmn2r61 T A 7: 42,300,276 C707S probably damaging Het
Vps13b T C 15: 35,841,320 S2499P probably damaging Het
Ythdf3 A G 3: 16,205,015 E442G possibly damaging Het
Other mutations in Apol7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Apol7c APN 15 77526437 missense probably damaging 1.00
IGL01653:Apol7c APN 15 77526300 missense probably damaging 1.00
IGL02169:Apol7c APN 15 77526416 missense possibly damaging 0.87
IGL02262:Apol7c APN 15 77525813 missense probably benign 0.20
IGL02375:Apol7c APN 15 77528849 missense probably damaging 0.98
IGL02645:Apol7c APN 15 77528883 missense probably benign 0.19
IGL02934:Apol7c APN 15 77526118 missense possibly damaging 0.51
IGL03127:Apol7c APN 15 77525906 missense probably benign 0.16
R0130:Apol7c UTSW 15 77526362 missense possibly damaging 0.52
R0659:Apol7c UTSW 15 77526273 missense probably damaging 0.99
R1638:Apol7c UTSW 15 77526218 missense probably damaging 0.97
R1980:Apol7c UTSW 15 77526044 missense probably benign 0.16
R4366:Apol7c UTSW 15 77526389 missense probably benign 0.07
R4466:Apol7c UTSW 15 77526464 missense probably benign 0.00
R4624:Apol7c UTSW 15 77526395 missense probably damaging 1.00
R4629:Apol7c UTSW 15 77526395 missense probably damaging 1.00
R4706:Apol7c UTSW 15 77525723 missense probably benign 0.05
R5367:Apol7c UTSW 15 77526147 missense probably damaging 1.00
R5586:Apol7c UTSW 15 77526399 missense possibly damaging 0.81
R6239:Apol7c UTSW 15 77526431 missense probably benign 0.28
R6860:Apol7c UTSW 15 77526074 missense probably benign 0.02
R7179:Apol7c UTSW 15 77525643 missense probably benign 0.01
R7234:Apol7c UTSW 15 77525675 nonsense probably null
R7513:Apol7c UTSW 15 77525711 missense possibly damaging 0.51
R7779:Apol7c UTSW 15 77525746 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCTTTCTGCACCTGTTTAG -3'
(R):5'- TGGAGTCCTGACCATCCTTG -3'

Sequencing Primer
(F):5'- TTCCTGTGGTCATGAGACGCC -3'
(R):5'- CTTGGTCTGGCTCTGGCAC -3'
Posted On2021-01-18