Incidental Mutation 'R8499:Nedd4l'
ID658445
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Nameneural precursor cell expressed, developmentally down-regulated gene 4-like
SynonymsNedd4-2, Nedd4b, 1300012C07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R8499 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location64887705-65217831 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65209657 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 888 (V888E)
Ref Sequence ENSEMBL: ENSMUSP00000132838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080418
AA Change: V767E

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: V767E

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163516
AA Change: V888E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: V888E

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224347
AA Change: V747E

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226058
AA Change: V767E

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 40,755,152 D485G probably damaging Het
Ap4b1 G A 3: 103,820,702 R344Q probably damaging Het
Apol7c G T 15: 77,526,080 P222Q possibly damaging Het
Atf6b T C 17: 34,650,822 L272P probably damaging Het
Atp11b G T 3: 35,810,705 R559I probably benign Het
Bhmt T A 13: 93,620,092 I343F probably benign Het
Btbd7 A T 12: 102,788,372 F712I probably damaging Het
Card14 T C 11: 119,331,244 L455P probably benign Het
Cast A T 13: 74,798,716 H26Q probably benign Het
Clcn1 A G 6: 42,307,199 N567S probably damaging Het
Cnot6l A T 5: 96,077,317 W506R probably damaging Het
Dynap T A 18: 70,240,973 I161L unknown Het
Eif4g3 A C 4: 138,165,928 T996P probably damaging Het
Exoc8 A G 8: 124,897,110 Y173H probably benign Het
Fbll1 C T 11: 35,798,080 V119M probably damaging Het
Fbxw22 A T 9: 109,385,000 F249L probably benign Het
Fxyd1 C A 7: 31,053,104 probably benign Het
Gm10130 T C 2: 150,362,987 S74P probably benign Het
Grhl3 C A 4: 135,549,238 probably null Het
Grk4 A G 5: 34,745,346 E414G possibly damaging Het
H2-Q5 A G 17: 35,394,844 D123G Het
H2-Q5 C T 17: 35,394,969 R165* probably null Het
Hgf A T 5: 16,566,856 E160D probably damaging Het
Hist1h2bg T A 13: 23,571,706 S92T probably benign Het
Ifi211 T C 1: 173,905,520 I192V probably benign Het
Klk1b22 T C 7: 44,112,720 F7L probably benign Het
Lcmt1 C A 7: 123,430,148 T331N probably benign Het
Lrrc36 A T 8: 105,449,536 T181S possibly damaging Het
Ltbp3 T A 19: 5,748,684 S520T probably benign Het
Nacc1 A T 8: 84,676,716 C177S probably damaging Het
Oc90 C T 15: 65,881,556 G305S probably damaging Het
Olfr556 T A 7: 102,670,805 I295N probably damaging Het
Olfr559 A G 7: 102,723,725 V255A probably damaging Het
Pappa2 T A 1: 158,936,522 D473V probably damaging Het
Pou2f2 C A 7: 25,100,198 G117C probably damaging Het
Prkci A G 3: 31,025,217 H68R probably damaging Het
Pygm A G 19: 6,390,362 K479E probably damaging Het
Qpct A G 17: 79,077,567 D212G probably damaging Het
Sh3glb2 A T 2: 30,359,204 M1K probably null Het
Slc22a5 A G 11: 53,867,643 S444P probably damaging Het
Snai3 G A 8: 122,456,405 H134Y probably benign Het
Synpo T C 18: 60,602,972 D395G probably damaging Het
Tmem63c C T 12: 87,072,964 T344I probably damaging Het
Tnfsf14 A G 17: 57,190,534 Y233H Het
Ttn A G 2: 76,918,991 F3905L probably benign Het
Tubgcp5 T A 7: 55,804,615 H219Q possibly damaging Het
Usp16 C T 16: 87,474,648 T364M possibly damaging Het
Vmn1r59 C T 7: 5,454,751 M3I probably benign Het
Vmn2r61 T A 7: 42,300,276 C707S probably damaging Het
Vps13b T C 15: 35,841,320 S2499P probably damaging Het
Ythdf3 A G 3: 16,205,015 E442G possibly damaging Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65208092 missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65172399 missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65172954 missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65208045 splice site probably benign
IGL02440:Nedd4l APN 18 65163173 critical splice donor site probably null
IGL02444:Nedd4l APN 18 65203957 splice site probably benign
IGL02700:Nedd4l APN 18 65209680 missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65161652 critical splice donor site probably null
IGL02999:Nedd4l APN 18 65198707 missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65205670 missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65181320 splice site probably benign
R0036:Nedd4l UTSW 18 65051123 intron probably benign
R0396:Nedd4l UTSW 18 65161654 splice site probably benign
R0472:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65173021 missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65195185 splice site probably benign
R0609:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65208503 splice site probably benign
R1077:Nedd4l UTSW 18 65167499 splice site probably benign
R1643:Nedd4l UTSW 18 65198641 missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65157939 missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65212791 missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65167575 critical splice donor site probably null
R1986:Nedd4l UTSW 18 65143803 missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65212820 missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65163130 missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65178978 missense probably benign 0.00
R3500:Nedd4l UTSW 18 65212860 missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65167535 missense probably benign
R4435:Nedd4l UTSW 18 65212825 missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65203880 missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65165605 missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65172927 missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65203945 missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65080060 nonsense probably null
R5106:Nedd4l UTSW 18 65193305 missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65191447 missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65174244 critical splice donor site probably null
R6465:Nedd4l UTSW 18 65155264 missense probably benign 0.06
R6479:Nedd4l UTSW 18 65209681 missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65174234 missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65167551 missense probably benign 0.36
R7065:Nedd4l UTSW 18 65195969 missense probably benign 0.04
R7068:Nedd4l UTSW 18 65205651 missense probably damaging 1.00
R7193:Nedd4l UTSW 18 64997370 missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65080018 missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65186367 missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65074774 missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65209698 missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65191489 missense probably damaging 0.98
R8440:Nedd4l UTSW 18 64889055 splice site probably null
R8557:Nedd4l UTSW 18 65203915 missense probably benign 0.00
R8801:Nedd4l UTSW 18 65155275 missense probably damaging 1.00
RF013:Nedd4l UTSW 18 65209680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGAAAGGCTGGGATTGTAGC -3'
(R):5'- GAAGCCCTCTGTTCTGCATC -3'

Sequencing Primer
(F):5'- CTGGGATTGTAGCGACTGTTATAAAG -3'
(R):5'- CCGTGGGTCTCTGTGGAACTAATAC -3'
Posted On2021-01-18