Incidental Mutation 'R8499:Pygm'
ID658448
Institutional Source Beutler Lab
Gene Symbol Pygm
Ensembl Gene ENSMUSG00000032648
Gene Namemuscle glycogen phosphorylase
SynonymsPG
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8499 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location6384399-6398459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6390362 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 479 (K479E)
Ref Sequence ENSEMBL: ENSMUSP00000047564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035269] [ENSMUST00000113483]
Predicted Effect probably damaging
Transcript: ENSMUST00000035269
AA Change: K479E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047564
Gene: ENSMUSG00000032648
AA Change: K479E

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113483
AA Change: K391E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109111
Gene: ENSMUSG00000032648
AA Change: K391E

DomainStartEndE-ValueType
Pfam:Phosphorylase 62 742 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: This gene encodes a glycolysis enzyme found in muscle. Highly similar enzymes encoded by different genes are found in liver and brain. The encoded protein is involved in regulating the breakdown of glycogen to glucose-1-phosphate, which is necessary for ATP generation. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null mutation exhibit massive muscle glycogen accumulation, elevated creatine kinase levels in blood, and very poor exercise performance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 40,755,152 D485G probably damaging Het
Ap4b1 G A 3: 103,820,702 R344Q probably damaging Het
Apol7c G T 15: 77,526,080 P222Q possibly damaging Het
Atf6b T C 17: 34,650,822 L272P probably damaging Het
Atp11b G T 3: 35,810,705 R559I probably benign Het
Bhmt T A 13: 93,620,092 I343F probably benign Het
Btbd7 A T 12: 102,788,372 F712I probably damaging Het
Card14 T C 11: 119,331,244 L455P probably benign Het
Cast A T 13: 74,798,716 H26Q probably benign Het
Clcn1 A G 6: 42,307,199 N567S probably damaging Het
Cnot6l A T 5: 96,077,317 W506R probably damaging Het
Dynap T A 18: 70,240,973 I161L unknown Het
Eif4g3 A C 4: 138,165,928 T996P probably damaging Het
Exoc8 A G 8: 124,897,110 Y173H probably benign Het
Fbll1 C T 11: 35,798,080 V119M probably damaging Het
Fbxw22 A T 9: 109,385,000 F249L probably benign Het
Fxyd1 C A 7: 31,053,104 probably benign Het
Gm10130 T C 2: 150,362,987 S74P probably benign Het
Grhl3 C A 4: 135,549,238 probably null Het
Grk4 A G 5: 34,745,346 E414G possibly damaging Het
H2-Q5 A G 17: 35,394,844 D123G Het
H2-Q5 C T 17: 35,394,969 R165* probably null Het
Hgf A T 5: 16,566,856 E160D probably damaging Het
Hist1h2bg T A 13: 23,571,706 S92T probably benign Het
Ifi211 T C 1: 173,905,520 I192V probably benign Het
Klk1b22 T C 7: 44,112,720 F7L probably benign Het
Lcmt1 C A 7: 123,430,148 T331N probably benign Het
Lrrc36 A T 8: 105,449,536 T181S possibly damaging Het
Ltbp3 T A 19: 5,748,684 S520T probably benign Het
Nacc1 A T 8: 84,676,716 C177S probably damaging Het
Nedd4l T A 18: 65,209,657 V888E probably damaging Het
Oc90 C T 15: 65,881,556 G305S probably damaging Het
Olfr556 T A 7: 102,670,805 I295N probably damaging Het
Olfr559 A G 7: 102,723,725 V255A probably damaging Het
Pappa2 T A 1: 158,936,522 D473V probably damaging Het
Pou2f2 C A 7: 25,100,198 G117C probably damaging Het
Prkci A G 3: 31,025,217 H68R probably damaging Het
Qpct A G 17: 79,077,567 D212G probably damaging Het
Sh3glb2 A T 2: 30,359,204 M1K probably null Het
Slc22a5 A G 11: 53,867,643 S444P probably damaging Het
Snai3 G A 8: 122,456,405 H134Y probably benign Het
Synpo T C 18: 60,602,972 D395G probably damaging Het
Tmem63c C T 12: 87,072,964 T344I probably damaging Het
Tnfsf14 A G 17: 57,190,534 Y233H Het
Ttn A G 2: 76,918,991 F3905L probably benign Het
Tubgcp5 T A 7: 55,804,615 H219Q possibly damaging Het
Usp16 C T 16: 87,474,648 T364M possibly damaging Het
Vmn1r59 C T 7: 5,454,751 M3I probably benign Het
Vmn2r61 T A 7: 42,300,276 C707S probably damaging Het
Vps13b T C 15: 35,841,320 S2499P probably damaging Het
Ythdf3 A G 3: 16,205,015 E442G possibly damaging Het
Other mutations in Pygm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Pygm APN 19 6391394 missense probably benign
IGL01743:Pygm APN 19 6392994 splice site probably null
IGL01827:Pygm APN 19 6390377 missense probably damaging 1.00
IGL02032:Pygm APN 19 6388087 missense probably benign 0.23
IGL02261:Pygm APN 19 6388271 missense probably damaging 1.00
IGL02431:Pygm APN 19 6388118 missense probably damaging 1.00
IGL02511:Pygm APN 19 6385688 missense probably benign 0.22
IGL02967:Pygm APN 19 6393838 missense probably damaging 1.00
IGL03081:Pygm APN 19 6388821 missense possibly damaging 0.53
R0336:Pygm UTSW 19 6388758 missense probably damaging 1.00
R0415:Pygm UTSW 19 6391366 missense probably benign 0.06
R0799:Pygm UTSW 19 6386018 intron probably benign
R1445:Pygm UTSW 19 6389887 missense probably benign 0.20
R1752:Pygm UTSW 19 6391034 missense probably damaging 0.99
R1828:Pygm UTSW 19 6397607 missense possibly damaging 0.72
R2054:Pygm UTSW 19 6388155 missense probably benign 0.02
R2086:Pygm UTSW 19 6391481 critical splice donor site probably null
R2116:Pygm UTSW 19 6386408 missense probably damaging 0.98
R2431:Pygm UTSW 19 6393785 missense probably damaging 1.00
R2516:Pygm UTSW 19 6397601 missense probably benign 0.20
R3938:Pygm UTSW 19 6392950 missense probably benign 0.42
R4609:Pygm UTSW 19 6391409 missense possibly damaging 0.92
R4924:Pygm UTSW 19 6393724 missense probably damaging 1.00
R4995:Pygm UTSW 19 6398139 missense probably damaging 1.00
R5225:Pygm UTSW 19 6389464 missense probably benign 0.01
R5296:Pygm UTSW 19 6384579 missense probably damaging 1.00
R5437:Pygm UTSW 19 6390382 missense probably damaging 1.00
R5994:Pygm UTSW 19 6398043 critical splice acceptor site probably null
R6030:Pygm UTSW 19 6388812 missense possibly damaging 0.78
R6030:Pygm UTSW 19 6388812 missense possibly damaging 0.78
R6188:Pygm UTSW 19 6397937 splice site probably null
R6266:Pygm UTSW 19 6398139 missense probably damaging 1.00
R6799:Pygm UTSW 19 6398127 missense probably damaging 1.00
R6855:Pygm UTSW 19 6393757 missense probably damaging 1.00
R6856:Pygm UTSW 19 6393757 missense probably damaging 1.00
R6857:Pygm UTSW 19 6393757 missense probably damaging 1.00
R7223:Pygm UTSW 19 6388863 missense probably benign
R7256:Pygm UTSW 19 6385896 missense probably benign 0.01
R7263:Pygm UTSW 19 6388327 missense probably damaging 1.00
R7398:Pygm UTSW 19 6385936 missense probably damaging 1.00
R8093:Pygm UTSW 19 6386042 missense probably damaging 1.00
R8351:Pygm UTSW 19 6388087 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GATGACGCCCTCTTACACACAG -3'
(R):5'- AGCCTTGGGAACACAGTACAG -3'

Sequencing Primer
(F):5'- TTACACACAGCACCCCTACCTG -3'
(R):5'- ACACAGTACAGGATTGTAGTCC -3'
Posted On2021-01-18