Incidental Mutation 'R8500:Zfp735'
ID 658482
Institutional Source Beutler Lab
Gene Symbol Zfp735
Ensembl Gene ENSMUSG00000060630
Gene Name zinc finger protein 735
Synonyms 1700012C15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R8500 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 73688778-73713798 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 73710985 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 252 (L252V)
Ref Sequence ENSEMBL: ENSMUSP00000079269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080407]
AlphaFold B1ARH2
Predicted Effect possibly damaging
Transcript: ENSMUST00000080407
AA Change: L252V

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079269
Gene: ENSMUSG00000060630
AA Change: L252V

DomainStartEndE-ValueType
KRAB 8 68 2.2e-34 SMART
ZnF_C2H2 483 505 4.38e1 SMART
ZnF_C2H2 511 533 2.67e-1 SMART
ZnF_C2H2 539 561 1.81e1 SMART
ZnF_C2H2 567 589 1.5e-4 SMART
ZnF_C2H2 595 617 4.87e-4 SMART
ZnF_C2H2 623 645 4.24e-4 SMART
ZnF_C2H2 651 673 2.27e-4 SMART
ZnF_C2H2 679 701 7.49e-5 SMART
ZnF_C2H2 707 729 4.87e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik C T 15: 84,987,635 S56N probably benign Het
Atg16l2 T G 7: 101,290,266 D542A probably damaging Het
Blm A G 7: 80,455,284 L1412P probably damaging Het
Cdc37 T C 9: 21,140,801 D314G probably damaging Het
Cela1 T A 15: 100,675,332 M39L probably benign Het
Col12a1 T A 9: 79,609,851 D2849V probably damaging Het
Fam53c A G 18: 34,768,801 E257G probably damaging Het
Fmo9 A T 1: 166,674,470 N144K probably damaging Het
Gabrd T A 4: 155,385,691 M354L probably benign Het
Gm5773 A T 3: 93,773,528 D169V probably benign Het
Gria2 A T 3: 80,692,467 F703L probably damaging Het
Grm3 A T 5: 9,511,726 I708N probably benign Het
Hlcs G A 16: 94,262,758 P481L possibly damaging Het
Ifi206 T C 1: 173,486,745 Y43C Het
Igf2r A G 17: 12,709,441 L1005P probably damaging Het
Ighv2-6-8 T C 12: 113,796,214 N92D possibly damaging Het
Invs A G 4: 48,422,109 K914E probably damaging Het
Iqsec3 T C 6: 121,412,854 probably benign Het
Klra6 T C 6: 130,022,697 T103A probably benign Het
Lipo5 C T 19: 33,464,449 probably null Het
Llgl1 T C 11: 60,704,983 probably null Het
Lonrf1 T C 8: 36,231,138 E402G probably benign Het
Lrp1b T A 2: 41,506,779 Y311F probably benign Het
Lrrc8a T A 2: 30,256,196 W341R possibly damaging Het
Lrriq1 A G 10: 103,046,155 I117T Het
Mmp9 T C 2: 164,953,566 V668A possibly damaging Het
Naip5 A C 13: 100,222,712 M672R probably damaging Het
Ncam1 A T 9: 49,520,145 L664Q probably damaging Het
Nol4l T C 2: 153,436,346 D234G probably damaging Het
Olfr1101 T C 2: 86,988,478 K233E probably damaging Het
Oscp1 T A 4: 126,077,410 H170Q possibly damaging Het
Pard3 T A 8: 127,460,303 M1021K probably damaging Het
Pkd1l2 T A 8: 117,047,563 probably null Het
Plcxd2 T C 16: 45,980,586 K92E probably damaging Het
Pqlc2 A G 4: 139,300,129 probably benign Het
Ptpdc1 A T 13: 48,586,283 C557* probably null Het
Robo2 G A 16: 73,948,340 T849I probably damaging Het
Rp1 A T 1: 4,346,590 I1433N possibly damaging Het
Scarb1 A G 5: 125,294,163 S282P probably damaging Het
Schip1 G T 3: 68,494,613 G36C probably damaging Het
Sf3a1 T A 11: 4,175,039 S357T probably benign Het
Sh3glb2 A T 2: 30,359,204 M1K probably null Het
Slc1a3 T C 15: 8,642,369 T368A probably damaging Het
Taf11 A T 17: 27,902,620 I138N probably damaging Het
Tnfaip8l1 C T 17: 56,171,749 A13V probably damaging Het
Trav6-2 T G 14: 52,667,635 F38V probably benign Het
Vmn2r73 A G 7: 85,870,430 V440A probably benign Het
Zfp292 A G 4: 34,826,691 probably null Het
Zfp429 A T 13: 67,390,709 C205* probably null Het
Zfyve26 A T 12: 79,287,680 L188Q probably damaging Het
Other mutations in Zfp735
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Zfp735 APN 11 73711366 missense possibly damaging 0.86
IGL00798:Zfp735 APN 11 73711560 missense possibly damaging 0.72
IGL01642:Zfp735 APN 11 73710479 missense possibly damaging 0.73
IGL01684:Zfp735 APN 11 73690365 missense possibly damaging 0.86
IGL02096:Zfp735 APN 11 73711428 missense probably benign 0.01
IGL02238:Zfp735 APN 11 73710493 missense probably benign 0.00
IGL02505:Zfp735 APN 11 73689800 missense probably benign 0.03
IGL02740:Zfp735 APN 11 73710586 missense possibly damaging 0.53
IGL02957:Zfp735 APN 11 73710929 missense probably benign 0.00
bananaquit UTSW 11 73710586 nonsense probably null
bescher UTSW 11 73712153 missense possibly damaging 0.93
Galvanic UTSW 11 73711678 nonsense probably null
grassquit UTSW 11 73712203 missense possibly damaging 0.66
R0114:Zfp735 UTSW 11 73710662 missense probably benign 0.33
R0217:Zfp735 UTSW 11 73711286 missense possibly damaging 0.73
R0943:Zfp735 UTSW 11 73712083 missense probably benign 0.04
R1421:Zfp735 UTSW 11 73710697 missense probably benign
R1460:Zfp735 UTSW 11 73712333 missense possibly damaging 0.73
R1493:Zfp735 UTSW 11 73710479 missense possibly damaging 0.73
R1517:Zfp735 UTSW 11 73710644 missense probably benign
R1676:Zfp735 UTSW 11 73711475 missense possibly damaging 0.53
R1709:Zfp735 UTSW 11 73711763 missense probably benign 0.01
R1871:Zfp735 UTSW 11 73710586 nonsense probably null
R1931:Zfp735 UTSW 11 73711851 missense possibly damaging 0.69
R2219:Zfp735 UTSW 11 73711025 missense possibly damaging 0.53
R2227:Zfp735 UTSW 11 73711396 missense possibly damaging 0.53
R2227:Zfp735 UTSW 11 73711397 nonsense probably null
R3552:Zfp735 UTSW 11 73711241 nonsense probably null
R3856:Zfp735 UTSW 11 73711456 missense probably benign 0.01
R3925:Zfp735 UTSW 11 73711124 missense probably benign 0.33
R4572:Zfp735 UTSW 11 73689785 missense probably benign 0.02
R4585:Zfp735 UTSW 11 73689724 missense possibly damaging 0.51
R4586:Zfp735 UTSW 11 73689724 missense possibly damaging 0.51
R4619:Zfp735 UTSW 11 73711205 missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73711855 missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73711856 missense probably damaging 0.98
R5435:Zfp735 UTSW 11 73712113 missense possibly damaging 0.72
R5489:Zfp735 UTSW 11 73710593 nonsense probably null
R5516:Zfp735 UTSW 11 73710814 missense probably benign
R5654:Zfp735 UTSW 11 73712138 missense possibly damaging 0.71
R5990:Zfp735 UTSW 11 73690348 missense possibly damaging 0.70
R6332:Zfp735 UTSW 11 73711678 nonsense probably null
R6427:Zfp735 UTSW 11 73690314 missense possibly damaging 0.73
R6460:Zfp735 UTSW 11 73711652 missense probably benign 0.33
R6820:Zfp735 UTSW 11 73688957 start codon destroyed probably null 0.01
R6831:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6833:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6834:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6897:Zfp735 UTSW 11 73711054 missense probably benign 0.08
R6941:Zfp735 UTSW 11 73690333 missense probably benign 0.33
R7335:Zfp735 UTSW 11 73711553 missense possibly damaging 0.47
R7366:Zfp735 UTSW 11 73712153 missense possibly damaging 0.93
R7474:Zfp735 UTSW 11 73711176 missense possibly damaging 0.72
R7487:Zfp735 UTSW 11 73690328 missense possibly damaging 0.53
R7583:Zfp735 UTSW 11 73711107 missense possibly damaging 0.86
R7866:Zfp735 UTSW 11 73710803 missense probably benign 0.00
R8005:Zfp735 UTSW 11 73712314 nonsense probably null
R8551:Zfp735 UTSW 11 73712296 missense probably benign 0.06
R8754:Zfp735 UTSW 11 73712174 missense possibly damaging 0.85
R8769:Zfp735 UTSW 11 73690301 missense possibly damaging 0.53
R8794:Zfp735 UTSW 11 73712203 missense possibly damaging 0.66
R8835:Zfp735 UTSW 11 73710866 missense possibly damaging 0.53
R8869:Zfp735 UTSW 11 73711684 missense possibly damaging 0.53
R8969:Zfp735 UTSW 11 73711873 missense possibly damaging 0.83
R9072:Zfp735 UTSW 11 73712234 missense probably benign 0.21
R9073:Zfp735 UTSW 11 73712234 missense probably benign 0.21
R9193:Zfp735 UTSW 11 73689774 missense possibly damaging 0.71
R9355:Zfp735 UTSW 11 73711536 missense probably benign 0.01
R9414:Zfp735 UTSW 11 73711197 nonsense probably null
R9456:Zfp735 UTSW 11 73711577 missense possibly damaging 0.53
R9573:Zfp735 UTSW 11 73712110 missense possibly damaging 0.67
Z1176:Zfp735 UTSW 11 73710815 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGGTGAATAAACACACTTCTCTGAAG -3'
(R):5'- GACCTAGCCTGTCTACTATCATGG -3'

Sequencing Primer
(F):5'- ACACACTTCTCTGAAGCATTTAC -3'
(R):5'- CCCTCCAAGTTGATTGTTTT -3'
Posted On 2021-01-18