Incidental Mutation 'R8500:Igf2r'
ID 658495
Institutional Source Beutler Lab
Gene Symbol Igf2r
Ensembl Gene ENSMUSG00000023830
Gene Name insulin-like growth factor 2 receptor
Synonyms IGF-II/CI-MPR, CD222, mannose-6-phosphate receptor, cation independent, M6P/IGF2R, Mpr300, CI-MPR
MMRRC Submission 067942-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.905) question?
Stock # R8500 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 12901293-12988551 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12928328 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1005 (L1005P)
Ref Sequence ENSEMBL: ENSMUSP00000024599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024599]
AlphaFold Q07113
Predicted Effect probably damaging
Transcript: ENSMUST00000024599
AA Change: L1005P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: L1005P

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
Pfam:CIMR 118 266 5.1e-21 PFAM
Pfam:CIMR 272 416 8.8e-22 PFAM
Pfam:CIMR 418 567 3.4e-53 PFAM
Pfam:CIMR 569 709 6.5e-47 PFAM
Pfam:CIMR 713 869 6.5e-34 PFAM
Pfam:CIMR 876 1020 1.9e-10 PFAM
Pfam:CIMR 1024 1171 1e-60 PFAM
Pfam:CIMR 1172 1313 1.2e-17 PFAM
Pfam:CIMR 1315 1455 2.1e-58 PFAM
Pfam:CIMR 1458 1592 1.8e-22 PFAM
Pfam:CIMR 1596 1743 9.1e-23 PFAM
Pfam:CIMR 1748 1887 2.5e-22 PFAM
FN2 1889 1935 9.51e-26 SMART
Pfam:CIMR 1939 2076 2.1e-22 PFAM
Pfam:CIMR 2230 2294 4.9e-9 PFAM
transmembrane domain 2295 2317 N/A INTRINSIC
low complexity region 2336 2363 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik C T 15: 84,871,836 (GRCm39) S56N probably benign Het
Atg16l2 T G 7: 100,939,473 (GRCm39) D542A probably damaging Het
Blm A G 7: 80,105,032 (GRCm39) L1412P probably damaging Het
Cdc37 T C 9: 21,052,097 (GRCm39) D314G probably damaging Het
Cela1 T A 15: 100,573,213 (GRCm39) M39L probably benign Het
Col12a1 T A 9: 79,517,133 (GRCm39) D2849V probably damaging Het
Fam53c A G 18: 34,901,854 (GRCm39) E257G probably damaging Het
Fmo9 A T 1: 166,502,039 (GRCm39) N144K probably damaging Het
Gabrd T A 4: 155,470,148 (GRCm39) M354L probably benign Het
Gm5773 A T 3: 93,680,835 (GRCm39) D169V probably benign Het
Gria2 A T 3: 80,599,774 (GRCm39) F703L probably damaging Het
Grm3 A T 5: 9,561,726 (GRCm39) I708N probably benign Het
Hlcs G A 16: 94,063,617 (GRCm39) P481L possibly damaging Het
Ifi206 T C 1: 173,314,311 (GRCm39) Y43C Het
Ighv2-6-8 T C 12: 113,759,834 (GRCm39) N92D possibly damaging Het
Invs A G 4: 48,422,109 (GRCm39) K914E probably damaging Het
Iqsec3 T C 6: 121,389,813 (GRCm39) probably benign Het
Klra6 T C 6: 129,999,660 (GRCm39) T103A probably benign Het
Lipo5 C T 19: 33,441,849 (GRCm39) probably null Het
Llgl1 T C 11: 60,595,809 (GRCm39) probably null Het
Lonrf1 T C 8: 36,698,292 (GRCm39) E402G probably benign Het
Lrp1b T A 2: 41,396,791 (GRCm39) Y311F probably benign Het
Lrrc8a T A 2: 30,146,208 (GRCm39) W341R possibly damaging Het
Lrriq1 A G 10: 102,882,016 (GRCm39) I117T Het
Mmp9 T C 2: 164,795,486 (GRCm39) V668A possibly damaging Het
Naip5 A C 13: 100,359,220 (GRCm39) M672R probably damaging Het
Ncam1 A T 9: 49,431,445 (GRCm39) L664Q probably damaging Het
Nol4l T C 2: 153,278,266 (GRCm39) D234G probably damaging Het
Or5t16 T C 2: 86,818,822 (GRCm39) K233E probably damaging Het
Oscp1 T A 4: 125,971,203 (GRCm39) H170Q possibly damaging Het
Pard3 T A 8: 128,186,784 (GRCm39) M1021K probably damaging Het
Pkd1l2 T A 8: 117,774,302 (GRCm39) probably null Het
Plcxd2 T C 16: 45,800,949 (GRCm39) K92E probably damaging Het
Ptpdc1 A T 13: 48,739,759 (GRCm39) C557* probably null Het
Robo2 G A 16: 73,745,228 (GRCm39) T849I probably damaging Het
Rp1 A T 1: 4,416,813 (GRCm39) I1433N possibly damaging Het
Scarb1 A G 5: 125,371,227 (GRCm39) S282P probably damaging Het
Schip1 G T 3: 68,401,946 (GRCm39) G36C probably damaging Het
Sf3a1 T A 11: 4,125,039 (GRCm39) S357T probably benign Het
Sh3glb2 A T 2: 30,249,216 (GRCm39) M1K probably null Het
Slc1a3 T C 15: 8,671,853 (GRCm39) T368A probably damaging Het
Slc66a1 A G 4: 139,027,440 (GRCm39) probably benign Het
Taf11 A T 17: 28,121,594 (GRCm39) I138N probably damaging Het
Tnfaip8l1 C T 17: 56,478,749 (GRCm39) A13V probably damaging Het
Trav6-2 T G 14: 52,905,092 (GRCm39) F38V probably benign Het
Vmn2r73 A G 7: 85,519,638 (GRCm39) V440A probably benign Het
Zfp292 A G 4: 34,826,691 (GRCm39) probably null Het
Zfp429 A T 13: 67,538,828 (GRCm39) C205* probably null Het
Zfp735 C G 11: 73,601,811 (GRCm39) L252V possibly damaging Het
Zfyve26 A T 12: 79,334,454 (GRCm39) L188Q probably damaging Het
Other mutations in Igf2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Igf2r APN 17 12,932,877 (GRCm39) missense probably benign 0.01
IGL00534:Igf2r APN 17 12,958,215 (GRCm39) missense probably damaging 0.97
IGL00902:Igf2r APN 17 12,919,245 (GRCm39) missense probably damaging 0.99
IGL00903:Igf2r APN 17 12,902,754 (GRCm39) missense possibly damaging 0.70
IGL01160:Igf2r APN 17 12,923,662 (GRCm39) missense possibly damaging 0.73
IGL01380:Igf2r APN 17 12,914,261 (GRCm39) missense probably benign 0.01
IGL01392:Igf2r APN 17 12,923,236 (GRCm39) missense probably benign
IGL01557:Igf2r APN 17 12,923,522 (GRCm39) missense possibly damaging 0.82
IGL01568:Igf2r APN 17 12,902,872 (GRCm39) missense possibly damaging 0.93
IGL01611:Igf2r APN 17 12,944,302 (GRCm39) nonsense probably null
IGL01720:Igf2r APN 17 12,920,200 (GRCm39) missense probably damaging 0.99
IGL01756:Igf2r APN 17 12,902,709 (GRCm39) missense probably benign
IGL01839:Igf2r APN 17 12,923,909 (GRCm39) missense probably damaging 1.00
IGL01904:Igf2r APN 17 12,933,798 (GRCm39) missense probably damaging 0.99
IGL01965:Igf2r APN 17 12,923,225 (GRCm39) missense probably benign 0.12
IGL02083:Igf2r APN 17 12,912,079 (GRCm39) nonsense probably null
IGL02095:Igf2r APN 17 12,920,892 (GRCm39) missense probably damaging 0.99
IGL02183:Igf2r APN 17 12,917,403 (GRCm39) unclassified probably benign
IGL02576:Igf2r APN 17 12,967,650 (GRCm39) missense possibly damaging 0.90
IGL02649:Igf2r APN 17 12,930,974 (GRCm39) missense possibly damaging 0.93
IGL02807:Igf2r APN 17 12,938,770 (GRCm39) missense probably damaging 0.98
IGL02833:Igf2r APN 17 12,911,610 (GRCm39) missense probably damaging 0.97
IGL02885:Igf2r APN 17 12,913,007 (GRCm39) missense possibly damaging 0.94
IGL02990:Igf2r APN 17 12,929,633 (GRCm39) splice site probably benign
IGL03080:Igf2r APN 17 12,945,563 (GRCm39) missense probably benign 0.06
IGL03176:Igf2r APN 17 12,935,559 (GRCm39) missense probably damaging 1.00
blunt UTSW 17 12,941,062 (GRCm39) missense probably benign 0.02
brusque UTSW 17 12,933,838 (GRCm39) missense probably damaging 0.98
gruff UTSW 17 12,902,984 (GRCm39) missense probably damaging 0.96
outlier UTSW 17 12,914,201 (GRCm39) missense probably benign 0.20
NA:Igf2r UTSW 17 12,910,849 (GRCm39) missense probably benign
R0165:Igf2r UTSW 17 12,917,414 (GRCm39) missense probably benign 0.07
R0412:Igf2r UTSW 17 12,902,835 (GRCm39) missense probably damaging 0.98
R0523:Igf2r UTSW 17 12,910,951 (GRCm39) missense probably benign 0.27
R0631:Igf2r UTSW 17 12,936,161 (GRCm39) splice site probably null
R0722:Igf2r UTSW 17 12,934,382 (GRCm39) critical splice acceptor site probably null
R0894:Igf2r UTSW 17 12,910,988 (GRCm39) missense probably benign 0.02
R1265:Igf2r UTSW 17 12,913,011 (GRCm39) missense probably damaging 0.98
R1466:Igf2r UTSW 17 12,936,156 (GRCm39) splice site probably benign
R1485:Igf2r UTSW 17 12,910,172 (GRCm39) missense probably damaging 1.00
R1633:Igf2r UTSW 17 12,945,196 (GRCm39) missense probably benign
R1693:Igf2r UTSW 17 12,923,203 (GRCm39) missense probably damaging 0.97
R1751:Igf2r UTSW 17 12,916,328 (GRCm39) missense possibly damaging 0.94
R1843:Igf2r UTSW 17 12,923,157 (GRCm39) critical splice donor site probably null
R1981:Igf2r UTSW 17 12,952,790 (GRCm39) nonsense probably null
R1994:Igf2r UTSW 17 12,911,625 (GRCm39) missense probably benign
R2060:Igf2r UTSW 17 12,920,206 (GRCm39) missense possibly damaging 0.92
R2108:Igf2r UTSW 17 12,917,138 (GRCm39) missense probably benign 0.02
R2132:Igf2r UTSW 17 12,941,095 (GRCm39) missense probably benign 0.12
R2314:Igf2r UTSW 17 12,934,830 (GRCm39) missense probably benign 0.28
R2349:Igf2r UTSW 17 12,941,198 (GRCm39) splice site probably null
R2696:Igf2r UTSW 17 12,914,231 (GRCm39) missense possibly damaging 0.96
R2864:Igf2r UTSW 17 12,905,611 (GRCm39) missense probably damaging 0.99
R2865:Igf2r UTSW 17 12,905,611 (GRCm39) missense probably damaging 0.99
R3884:Igf2r UTSW 17 12,928,355 (GRCm39) missense probably benign
R3930:Igf2r UTSW 17 12,924,716 (GRCm39) missense probably benign 0.01
R4021:Igf2r UTSW 17 12,967,638 (GRCm39) missense probably damaging 0.97
R4125:Igf2r UTSW 17 12,921,141 (GRCm39) missense possibly damaging 0.93
R4342:Igf2r UTSW 17 12,928,398 (GRCm39) missense possibly damaging 0.95
R4343:Igf2r UTSW 17 12,928,398 (GRCm39) missense possibly damaging 0.95
R4345:Igf2r UTSW 17 12,928,398 (GRCm39) missense possibly damaging 0.95
R4760:Igf2r UTSW 17 12,922,352 (GRCm39) missense possibly damaging 0.92
R4796:Igf2r UTSW 17 12,903,013 (GRCm39) missense possibly damaging 0.70
R4816:Igf2r UTSW 17 12,902,984 (GRCm39) missense probably damaging 0.96
R4826:Igf2r UTSW 17 12,920,240 (GRCm39) missense probably damaging 0.98
R4933:Igf2r UTSW 17 12,910,764 (GRCm39) splice site probably null
R4980:Igf2r UTSW 17 12,922,247 (GRCm39) critical splice donor site probably null
R5389:Igf2r UTSW 17 12,944,303 (GRCm39) missense probably damaging 1.00
R5473:Igf2r UTSW 17 12,914,201 (GRCm39) missense probably benign 0.20
R5494:Igf2r UTSW 17 12,912,032 (GRCm39) missense possibly damaging 0.74
R5619:Igf2r UTSW 17 12,958,221 (GRCm39) missense probably damaging 1.00
R5738:Igf2r UTSW 17 12,936,254 (GRCm39) missense probably benign 0.23
R5761:Igf2r UTSW 17 12,917,239 (GRCm39) splice site probably null
R5794:Igf2r UTSW 17 12,928,332 (GRCm39) missense probably benign 0.37
R6210:Igf2r UTSW 17 12,933,838 (GRCm39) missense probably damaging 0.98
R6319:Igf2r UTSW 17 12,933,000 (GRCm39) missense probably damaging 1.00
R6388:Igf2r UTSW 17 12,902,787 (GRCm39) missense probably benign
R6396:Igf2r UTSW 17 12,932,977 (GRCm39) missense probably benign 0.00
R6584:Igf2r UTSW 17 12,920,137 (GRCm39) missense probably damaging 0.99
R6590:Igf2r UTSW 17 12,910,824 (GRCm39) nonsense probably null
R6591:Igf2r UTSW 17 12,907,895 (GRCm39) missense probably damaging 1.00
R6599:Igf2r UTSW 17 12,917,505 (GRCm39) missense possibly damaging 0.85
R6690:Igf2r UTSW 17 12,910,824 (GRCm39) nonsense probably null
R6691:Igf2r UTSW 17 12,907,895 (GRCm39) missense probably damaging 1.00
R6752:Igf2r UTSW 17 12,933,831 (GRCm39) missense probably damaging 1.00
R6816:Igf2r UTSW 17 12,932,969 (GRCm39) missense probably damaging 0.99
R6841:Igf2r UTSW 17 12,922,263 (GRCm39) missense probably damaging 0.97
R6877:Igf2r UTSW 17 12,916,228 (GRCm39) missense probably damaging 0.97
R6950:Igf2r UTSW 17 12,937,605 (GRCm39) missense probably benign
R7030:Igf2r UTSW 17 12,952,753 (GRCm39) missense probably damaging 1.00
R7038:Igf2r UTSW 17 12,917,212 (GRCm39) missense probably benign 0.23
R7055:Igf2r UTSW 17 12,923,210 (GRCm39) missense probably damaging 0.99
R7074:Igf2r UTSW 17 12,933,003 (GRCm39) missense possibly damaging 0.57
R7348:Igf2r UTSW 17 12,922,371 (GRCm39) missense probably damaging 0.99
R7413:Igf2r UTSW 17 12,917,115 (GRCm39) nonsense probably null
R7463:Igf2r UTSW 17 12,929,532 (GRCm39) missense probably benign 0.16
R7619:Igf2r UTSW 17 12,917,160 (GRCm39) missense possibly damaging 0.88
R7730:Igf2r UTSW 17 12,954,878 (GRCm39) missense probably damaging 0.98
R7733:Igf2r UTSW 17 12,958,256 (GRCm39) missense possibly damaging 0.90
R7881:Igf2r UTSW 17 12,967,591 (GRCm39) missense probably benign
R8022:Igf2r UTSW 17 12,937,682 (GRCm39) missense probably damaging 1.00
R8138:Igf2r UTSW 17 12,920,125 (GRCm39) missense probably benign 0.32
R8220:Igf2r UTSW 17 12,910,958 (GRCm39) missense probably benign 0.22
R8305:Igf2r UTSW 17 12,952,747 (GRCm39) missense probably benign
R8359:Igf2r UTSW 17 12,902,748 (GRCm39) missense probably benign
R8510:Igf2r UTSW 17 12,923,200 (GRCm39) missense probably benign 0.38
R8933:Igf2r UTSW 17 12,923,524 (GRCm39) missense probably damaging 1.00
R8933:Igf2r UTSW 17 12,920,131 (GRCm39) missense probably damaging 0.97
R8976:Igf2r UTSW 17 12,945,659 (GRCm39) missense probably damaging 1.00
R8994:Igf2r UTSW 17 12,935,537 (GRCm39) missense possibly damaging 0.87
R9059:Igf2r UTSW 17 12,970,180 (GRCm39) start codon destroyed probably null
R9097:Igf2r UTSW 17 12,910,100 (GRCm39) missense probably damaging 1.00
R9127:Igf2r UTSW 17 12,958,238 (GRCm39) missense probably damaging 0.98
R9278:Igf2r UTSW 17 12,914,240 (GRCm39) missense probably damaging 1.00
R9362:Igf2r UTSW 17 12,941,062 (GRCm39) missense probably benign 0.02
R9371:Igf2r UTSW 17 12,924,646 (GRCm39) missense possibly damaging 0.93
R9522:Igf2r UTSW 17 12,917,215 (GRCm39) missense probably benign 0.26
R9567:Igf2r UTSW 17 12,905,641 (GRCm39) missense probably damaging 1.00
R9665:Igf2r UTSW 17 12,913,027 (GRCm39) missense probably benign 0.17
R9666:Igf2r UTSW 17 12,945,588 (GRCm39) missense probably benign
X0028:Igf2r UTSW 17 12,923,800 (GRCm39) nonsense probably null
Z1177:Igf2r UTSW 17 12,916,286 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCAGAATTGGCCTTTCACTTAC -3'
(R):5'- GTCTTGGAATCTAAATGGGCCTG -3'

Sequencing Primer
(F):5'- AGCTTAACATACCCAAACTGTTAC -3'
(R):5'- CAATATCTGTGGTGCAATGC -3'
Posted On 2021-01-18