Incidental Mutation 'R8519:Pcif1'
ID 658508
Institutional Source Beutler Lab
Gene Symbol Pcif1
Ensembl Gene ENSMUSG00000039849
Gene Name phosphorylated CTD interacting factor 1
Synonyms F730014I05Rik, 2310022K11Rik
MMRRC Submission 067946-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.222) question?
Stock # R8519 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 164721288-164733360 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 164726303 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 68 (N68S)
Ref Sequence ENSEMBL: ENSMUSP00000039555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041643]
AlphaFold P59114
Predicted Effect probably damaging
Transcript: ENSMUST00000041643
AA Change: N68S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039555
Gene: ENSMUSG00000039849
AA Change: N68S

DomainStartEndE-ValueType
WW 44 77 4.34e-4 SMART
low complexity region 132 148 N/A INTRINSIC
Pfam:PCIF1_WW 445 620 7.1e-74 PFAM
low complexity region 675 686 N/A INTRINSIC
Meta Mutation Damage Score 0.2550 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 T C 10: 61,038,619 (GRCm39) T964A possibly damaging Het
Adamts7 G A 9: 90,075,610 (GRCm39) W1156* probably null Het
Adcy9 T C 16: 4,105,992 (GRCm39) I1041V possibly damaging Het
Armh4 T C 14: 50,010,693 (GRCm39) D338G probably damaging Het
Art4 C A 6: 136,831,349 (GRCm39) probably null Het
Bcl9 A G 3: 97,116,334 (GRCm39) S787P probably benign Het
Bptf T C 11: 106,952,590 (GRCm39) T2088A probably damaging Het
Cdc45 T C 16: 18,627,597 (GRCm39) N76S probably damaging Het
Cdon A G 9: 35,389,950 (GRCm39) D868G probably damaging Het
Cldn10 T G 14: 119,092,439 (GRCm39) V13G probably benign Het
Cnot6 G T 11: 49,575,941 (GRCm39) Q178K probably benign Het
Crot T C 5: 9,023,629 (GRCm39) I420V probably benign Het
Csgalnact1 T A 8: 68,854,105 (GRCm39) H232L possibly damaging Het
Cuzd1 T C 7: 130,910,626 (GRCm39) I556M possibly damaging Het
Cyp2c54 G A 19: 40,026,857 (GRCm39) R433W probably damaging Het
Cyp2j11 A G 4: 96,207,539 (GRCm39) F259L probably benign Het
Dhx9 C T 1: 153,348,922 (GRCm39) G264R probably damaging Het
Dnah5 G A 15: 28,299,245 (GRCm39) V1536M probably benign Het
Erlin1 T A 19: 44,058,041 (GRCm39) probably benign Het
Foxb2 C A 19: 16,850,347 (GRCm39) V220L possibly damaging Het
Gigyf2 A T 1: 87,338,431 (GRCm39) T388S probably benign Het
Gimap5 T C 6: 48,730,068 (GRCm39) C213R probably benign Het
Gkap1 T G 13: 58,386,506 (GRCm39) K57N probably damaging Het
H60b T G 10: 22,159,421 (GRCm39) probably benign Het
Hectd4 C T 5: 121,442,489 (GRCm39) R670* probably null Het
Hoxc9 A G 15: 102,892,341 (GRCm39) N185D probably damaging Het
Igkv1-117 A G 6: 68,098,766 (GRCm39) E105G possibly damaging Het
Klk10 T A 7: 43,432,239 (GRCm39) Y57* probably null Het
Lrrc63 A T 14: 75,363,312 (GRCm39) I273K possibly damaging Het
M6pr T C 6: 122,292,025 (GRCm39) I119T probably damaging Het
Mael T C 1: 166,063,127 (GRCm39) probably null Het
Magi1 A G 6: 93,681,330 (GRCm39) S574P possibly damaging Het
Man2c1 A G 9: 57,044,061 (GRCm39) D291G probably benign Het
Mapk1ip1l A T 14: 47,547,920 (GRCm39) probably benign Het
Mrc2 A G 11: 105,238,132 (GRCm39) T1135A possibly damaging Het
Mrpl39 A G 16: 84,527,736 (GRCm39) V164A probably benign Het
Mynn C A 3: 30,661,290 (GRCm39) P124H probably damaging Het
Or11l3 T G 11: 58,516,800 (GRCm39) Q23P probably damaging Het
Or14n1-ps1 A T 7: 86,093,062 (GRCm39) N291I probably damaging Het
Or2k2 A G 4: 58,785,203 (GRCm39) I173T probably damaging Het
Or2t48 A G 11: 58,420,329 (GRCm39) F161S possibly damaging Het
Or6k2 A G 1: 173,986,614 (GRCm39) I92V probably damaging Het
Pcm1 T A 8: 41,728,976 (GRCm39) N649K probably damaging Het
Pira1 T C 7: 3,740,432 (GRCm39) Q263R probably benign Het
Plxna2 T A 1: 194,476,266 (GRCm39) I1162N probably damaging Het
Pnp2 T A 14: 51,201,842 (GRCm39) L276Q probably damaging Het
Sirpb1c T A 3: 15,902,526 (GRCm39) I18F possibly damaging Het
Slc2a12 A T 10: 22,540,678 (GRCm39) M178L probably damaging Het
Slc35c1 G T 2: 92,285,052 (GRCm39) F187L probably benign Het
Smg1 T C 7: 117,770,982 (GRCm39) probably benign Het
Spmip6 A G 4: 41,505,071 (GRCm39) S214P possibly damaging Het
Spopfm2 T C 3: 94,083,497 (GRCm39) M105V probably benign Het
Stn1 T C 19: 47,490,111 (GRCm39) H342R probably benign Het
Sult1c2 A T 17: 54,276,709 (GRCm39) H117Q probably damaging Het
Thap1 G A 8: 26,650,925 (GRCm39) R42K probably damaging Het
Tpp2 A T 1: 44,016,365 (GRCm39) probably null Het
Trib2 G T 12: 15,865,347 (GRCm39) P76Q probably damaging Het
Ttc24 G T 3: 87,980,369 (GRCm39) Q111K probably damaging Het
Ubr4 T C 4: 139,143,958 (GRCm39) S1401P probably damaging Het
Uggt1 A C 1: 36,215,724 (GRCm39) probably null Het
Ugt2b1 A G 5: 87,074,326 (GRCm39) L11S probably damaging Het
Uso1 T G 5: 92,343,222 (GRCm39) S769A probably benign Het
Vmn2r117 T C 17: 23,698,442 (GRCm39) T44A probably benign Het
Vmn2r28 T A 7: 5,489,347 (GRCm39) L497F probably benign Het
Vsig10l G A 7: 43,114,326 (GRCm39) S318N probably benign Het
Wbp4 A G 14: 79,714,263 (GRCm39) L83P probably damaging Het
Wnk1 G A 6: 119,927,044 (GRCm39) R1510W probably damaging Het
Zc3hav1l C T 6: 38,272,176 (GRCm39) V198M probably damaging Het
Zfp1004 A G 2: 150,034,700 (GRCm39) I340M probably benign Het
Other mutations in Pcif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Pcif1 APN 2 164,727,708 (GRCm39) missense probably damaging 1.00
IGL01598:Pcif1 APN 2 164,728,531 (GRCm39) missense possibly damaging 0.86
R0313:Pcif1 UTSW 2 164,726,339 (GRCm39) missense probably damaging 0.97
R0329:Pcif1 UTSW 2 164,731,364 (GRCm39) missense probably damaging 1.00
R0330:Pcif1 UTSW 2 164,731,364 (GRCm39) missense probably damaging 1.00
R1070:Pcif1 UTSW 2 164,731,058 (GRCm39) missense probably benign 0.01
R1350:Pcif1 UTSW 2 164,728,687 (GRCm39) missense probably damaging 0.99
R1467:Pcif1 UTSW 2 164,731,058 (GRCm39) missense probably benign 0.01
R1467:Pcif1 UTSW 2 164,731,058 (GRCm39) missense probably benign 0.01
R1583:Pcif1 UTSW 2 164,728,647 (GRCm39) missense probably damaging 1.00
R1640:Pcif1 UTSW 2 164,727,603 (GRCm39) missense probably benign
R1852:Pcif1 UTSW 2 164,730,386 (GRCm39) missense probably damaging 0.97
R2252:Pcif1 UTSW 2 164,732,799 (GRCm39) missense probably benign 0.05
R2571:Pcif1 UTSW 2 164,726,131 (GRCm39) missense probably damaging 1.00
R3879:Pcif1 UTSW 2 164,727,878 (GRCm39) missense probably benign 0.40
R4956:Pcif1 UTSW 2 164,731,610 (GRCm39) missense probably damaging 1.00
R5792:Pcif1 UTSW 2 164,727,299 (GRCm39) missense probably damaging 0.97
R5913:Pcif1 UTSW 2 164,726,412 (GRCm39) intron probably benign
R6798:Pcif1 UTSW 2 164,727,711 (GRCm39) missense possibly damaging 0.94
R6913:Pcif1 UTSW 2 164,726,224 (GRCm39) critical splice acceptor site probably null
R7359:Pcif1 UTSW 2 164,726,251 (GRCm39) missense probably damaging 1.00
R7453:Pcif1 UTSW 2 164,731,550 (GRCm39) missense possibly damaging 0.94
R7453:Pcif1 UTSW 2 164,730,284 (GRCm39) missense probably damaging 1.00
R7917:Pcif1 UTSW 2 164,730,392 (GRCm39) missense probably benign 0.08
R8031:Pcif1 UTSW 2 164,728,442 (GRCm39) missense probably damaging 1.00
R8474:Pcif1 UTSW 2 164,730,272 (GRCm39) missense probably damaging 1.00
R8553:Pcif1 UTSW 2 164,728,417 (GRCm39) missense probably damaging 1.00
R8766:Pcif1 UTSW 2 164,727,346 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGTTCTCCAAAGCCAGTTCG -3'
(R):5'- TGTCTGCCACAGAACAAGC -3'

Sequencing Primer
(F):5'- CCTGACTGTCTGGGTTGTA -3'
(R):5'- TGTCTGCCACAGAACAAGCCTATC -3'
Posted On 2021-01-18