Incidental Mutation 'R8519:Cyp2j11'
ID658516
Institutional Source Beutler Lab
Gene Symbol Cyp2j11
Ensembl Gene ENSMUSG00000066097
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 11
SynonymsCyp2j11-ps
Accession Numbers

Genbank: NM_001004141; MGI: 2140224

Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R8519 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location96294508-96348662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96319302 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 259 (F259L)
Ref Sequence ENSEMBL: ENSMUSP00000132180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015368]
Predicted Effect probably benign
Transcript: ENSMUST00000015368
AA Change: F259L

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132180
Gene: ENSMUSG00000066097
AA Change: F259L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 44 500 4.3e-133 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A G 4: 41,505,071 S214P possibly damaging Het
3632451O06Rik T C 14: 49,773,236 D338G probably damaging Het
Adamts14 T C 10: 61,202,840 T964A possibly damaging Het
Adamts7 G A 9: 90,193,557 W1156* probably null Het
Adcy9 T C 16: 4,288,128 I1041V possibly damaging Het
Art4 C A 6: 136,854,351 probably null Het
Bcl9 A G 3: 97,209,018 S787P probably benign Het
Bptf T C 11: 107,061,764 T2088A probably damaging Het
Cdc45 T C 16: 18,808,847 N76S probably damaging Het
Cdon A G 9: 35,478,654 D868G probably damaging Het
Cldn10 T G 14: 118,855,027 V13G probably benign Het
Cnot6 G T 11: 49,685,114 Q178K probably benign Het
Crot T C 5: 8,973,629 I420V probably benign Het
Csgalnact1 T A 8: 68,401,453 H232L possibly damaging Het
Cuzd1 T C 7: 131,308,897 I556M possibly damaging Het
Cyp2c54 G A 19: 40,038,413 R433W probably damaging Het
Dhx9 C T 1: 153,473,176 G264R probably damaging Het
Dnah5 G A 15: 28,299,099 V1536M probably benign Het
Erlin1 T A 19: 44,069,602 probably benign Het
Foxb2 C A 19: 16,872,983 V220L possibly damaging Het
Gigyf2 A T 1: 87,410,709 T388S probably benign Het
Gimap5 T C 6: 48,753,134 C213R probably benign Het
Gkap1 T G 13: 58,238,692 K57N probably damaging Het
Gm10696 T C 3: 94,176,190 M105V probably benign Het
Gm14139 A G 2: 150,192,780 I340M probably benign Het
Gm15922 T C 7: 3,737,433 Q263R probably benign Het
H60b T G 10: 22,283,522 probably benign Het
Hectd4 C T 5: 121,304,426 R670* probably null Het
Hoxc9 A G 15: 102,983,909 N185D probably damaging Het
Igkv1-117 A G 6: 68,121,782 E105G possibly damaging Het
Klk10 T A 7: 43,782,815 Y57* probably null Het
Lrrc63 A T 14: 75,125,872 I273K possibly damaging Het
M6pr T C 6: 122,315,066 I119T probably damaging Het
Mael T C 1: 166,235,558 probably null Het
Magi1 A G 6: 93,704,349 S574P possibly damaging Het
Man2c1 A G 9: 57,136,777 D291G probably benign Het
Mapk1ip1l A T 14: 47,310,463 probably benign Het
Mrc2 A G 11: 105,347,306 T1135A possibly damaging Het
Mrpl39 A G 16: 84,730,848 V164A probably benign Het
Mynn C A 3: 30,607,141 P124H probably damaging Het
Olfr267 A G 4: 58,785,203 I173T probably damaging Het
Olfr300-ps1 A T 7: 86,443,854 N291I probably damaging Het
Olfr323 T G 11: 58,625,974 Q23P probably damaging Het
Olfr330 A G 11: 58,529,503 F161S possibly damaging Het
Olfr420 A G 1: 174,159,048 I92V probably damaging Het
Pcif1 A G 2: 164,884,383 N68S probably damaging Het
Pcm1 T A 8: 41,275,939 N649K probably damaging Het
Plxna2 T A 1: 194,793,958 I1162N probably damaging Het
Pnp2 T A 14: 50,964,385 L276Q probably damaging Het
Sirpb1c T A 3: 15,848,362 I18F possibly damaging Het
Slc2a12 A T 10: 22,664,779 M178L probably damaging Het
Slc35c1 G T 2: 92,454,707 F187L probably benign Het
Smg1 T C 7: 118,171,759 probably benign Het
Stn1 T C 19: 47,501,672 H342R probably benign Het
Sult1c1 A T 17: 53,969,681 H117Q probably damaging Het
Thap1 G A 8: 26,160,897 R42K probably damaging Het
Tpp2 A T 1: 43,977,205 probably null Het
Trib2 G T 12: 15,815,346 P76Q probably damaging Het
Ttc24 G T 3: 88,073,062 Q111K probably damaging Het
Ubr4 T C 4: 139,416,647 S1401P probably damaging Het
Uggt1 A C 1: 36,176,643 probably null Het
Ugt2b1 A G 5: 86,926,467 L11S probably damaging Het
Uso1 T G 5: 92,195,363 S769A probably benign Het
Vmn2r117 T C 17: 23,479,468 T44A probably benign Het
Vmn2r28 T A 7: 5,486,348 L497F probably benign Het
Vsig10l G A 7: 43,464,902 S318N probably benign Het
Wbp4 A G 14: 79,476,823 L83P probably damaging Het
Wnk1 G A 6: 119,950,083 R1510W probably damaging Het
Zc3hav1l C T 6: 38,295,241 V198M probably damaging Het
Other mutations in Cyp2j11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Cyp2j11 APN 4 96339095 missense probably benign
IGL01816:Cyp2j11 APN 4 96294924 missense probably damaging 1.00
IGL02406:Cyp2j11 APN 4 96348539 missense possibly damaging 0.56
E7848:Cyp2j11 UTSW 4 96319365 missense probably benign 0.09
R0020:Cyp2j11 UTSW 4 96307404 missense probably benign 0.19
R0020:Cyp2j11 UTSW 4 96307404 missense probably benign 0.19
R1298:Cyp2j11 UTSW 4 96307260 critical splice donor site probably null
R1411:Cyp2j11 UTSW 4 96345216 missense probably benign 0.03
R1428:Cyp2j11 UTSW 4 96294880 missense probably benign 0.01
R1740:Cyp2j11 UTSW 4 96319376 missense probably benign 0.00
R1818:Cyp2j11 UTSW 4 96297739 missense probably damaging 0.97
R1819:Cyp2j11 UTSW 4 96297739 missense probably damaging 0.97
R1917:Cyp2j11 UTSW 4 96339974 missense probably damaging 1.00
R2084:Cyp2j11 UTSW 4 96339201 missense probably damaging 1.00
R2146:Cyp2j11 UTSW 4 96316358 missense probably damaging 1.00
R2148:Cyp2j11 UTSW 4 96316358 missense probably damaging 1.00
R2150:Cyp2j11 UTSW 4 96316358 missense probably damaging 1.00
R4963:Cyp2j11 UTSW 4 96316382 missense probably damaging 1.00
R5335:Cyp2j11 UTSW 4 96307352 missense probably damaging 1.00
R5450:Cyp2j11 UTSW 4 96339876 missense probably benign 0.44
R5688:Cyp2j11 UTSW 4 96345121 missense probably damaging 1.00
R5978:Cyp2j11 UTSW 4 96319352 missense probably damaging 1.00
R6061:Cyp2j11 UTSW 4 96348616 start gained probably benign
R6075:Cyp2j11 UTSW 4 96345085 missense probably benign 0.04
R6912:Cyp2j11 UTSW 4 96294871 missense probably benign 0.00
R7338:Cyp2j11 UTSW 4 96307287 missense possibly damaging 0.64
R7394:Cyp2j11 UTSW 4 96316440 missense probably benign 0.00
R7464:Cyp2j11 UTSW 4 96345120 missense probably damaging 1.00
R7972:Cyp2j11 UTSW 4 96297634 missense probably damaging 1.00
R8152:Cyp2j11 UTSW 4 96307292 missense probably damaging 1.00
R8328:Cyp2j11 UTSW 4 96348368 missense probably benign 0.03
R8383:Cyp2j11 UTSW 4 96348458 missense probably benign 0.00
R8789:Cyp2j11 UTSW 4 96339168 missense probably damaging 0.99
Z1176:Cyp2j11 UTSW 4 96307303 missense probably damaging 0.99
Z1176:Cyp2j11 UTSW 4 96307436 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCTCCATGATGCAAGGTC -3'
(R):5'- CACAGTTGAATCACCTGAAAATGC -3'

Sequencing Primer
(F):5'- GTCTCCATGATGCAAGGTCAATTAG -3'
(R):5'- TGCAGGTAAGCCAGAAACC -3'
Posted On2021-01-18