Incidental Mutation 'R8519:Ubr4'
ID 658517
Institutional Source Beutler Lab
Gene Symbol Ubr4
Ensembl Gene ENSMUSG00000066036
Gene Name ubiquitin protein ligase E3 component n-recognin 4
Synonyms p600, A930005E13Rik, LOC381562, D930005K06Rik, Zubr1, 1810009A16Rik
MMRRC Submission 067946-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8519 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 139107970-139216844 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 139143958 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1401 (S1401P)
Ref Sequence ENSEMBL: ENSMUSP00000125800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097822] [ENSMUST00000147999] [ENSMUST00000165860]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000097822
AA Change: S1401P

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095433
Gene: ENSMUSG00000066036
AA Change: S1401P

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 414 425 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 571 588 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1642 1655 N/A INTRINSIC
Pfam:zf-UBR 1660 1725 1.9e-9 PFAM
Blast:ZnF_C2H2 1966 1991 6e-8 BLAST
low complexity region 2268 2279 N/A INTRINSIC
low complexity region 2502 2540 N/A INTRINSIC
low complexity region 2725 2735 N/A INTRINSIC
low complexity region 2818 2852 N/A INTRINSIC
low complexity region 2887 2905 N/A INTRINSIC
low complexity region 2928 2942 N/A INTRINSIC
low complexity region 2945 2959 N/A INTRINSIC
low complexity region 2966 2986 N/A INTRINSIC
low complexity region 3063 3091 N/A INTRINSIC
low complexity region 3329 3385 N/A INTRINSIC
low complexity region 3776 3788 N/A INTRINSIC
Pfam:E3_UbLigase_R4 4364 5160 N/A PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000115711
Gene: ENSMUSG00000066036
AA Change: S112P

DomainStartEndE-ValueType
low complexity region 24 42 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:zf-UBR 372 437 2.1e-10 PFAM
Blast:ZnF_C2H2 678 703 5e-8 BLAST
low complexity region 980 991 N/A INTRINSIC
low complexity region 1225 1263 N/A INTRINSIC
low complexity region 1448 1458 N/A INTRINSIC
low complexity region 1575 1593 N/A INTRINSIC
low complexity region 1616 1630 N/A INTRINSIC
low complexity region 1633 1647 N/A INTRINSIC
low complexity region 1654 1674 N/A INTRINSIC
low complexity region 1751 1779 N/A INTRINSIC
low complexity region 2017 2045 N/A INTRINSIC
low complexity region 2048 2065 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165860
AA Change: S1401P

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125800
Gene: ENSMUSG00000066036
AA Change: S1401P

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 414 425 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 571 588 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1642 1655 N/A INTRINSIC
Pfam:zf-UBR 1659 1729 4e-13 PFAM
Blast:ZnF_C2H2 1966 1991 5e-8 BLAST
low complexity region 2268 2279 N/A INTRINSIC
low complexity region 2513 2551 N/A INTRINSIC
low complexity region 2736 2746 N/A INTRINSIC
low complexity region 2863 2881 N/A INTRINSIC
low complexity region 2904 2918 N/A INTRINSIC
low complexity region 2921 2935 N/A INTRINSIC
low complexity region 2942 2962 N/A INTRINSIC
low complexity region 3039 3067 N/A INTRINSIC
low complexity region 3305 3361 N/A INTRINSIC
low complexity region 3752 3764 N/A INTRINSIC
Pfam:E3_UbLigase_R4 4340 5136 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase that interacts with the retinoblastoma-associated protein in the nucleus and with calcium-bound calmodulin in the cytoplasm. The encoded protein appears to be a cytoskeletal component in the cytoplasm and part of the chromatin scaffold in the nucleus. In addition, this protein is a target of the human papillomavirus type 16 E7 oncoprotein. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit neonatal lethality and decreased body size at birth. Mice homozygous for a null mutation display complete embryonic lethality during organogenesis with arrest of vitelline vascular remodeling. [provided by MGI curators]
Allele List at MGI

All alleles(59) : Targeted(2) Gene trapped(56) Transgenic(1)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 T C 10: 61,038,619 (GRCm39) T964A possibly damaging Het
Adamts7 G A 9: 90,075,610 (GRCm39) W1156* probably null Het
Adcy9 T C 16: 4,105,992 (GRCm39) I1041V possibly damaging Het
Armh4 T C 14: 50,010,693 (GRCm39) D338G probably damaging Het
Art4 C A 6: 136,831,349 (GRCm39) probably null Het
Bcl9 A G 3: 97,116,334 (GRCm39) S787P probably benign Het
Bptf T C 11: 106,952,590 (GRCm39) T2088A probably damaging Het
Cdc45 T C 16: 18,627,597 (GRCm39) N76S probably damaging Het
Cdon A G 9: 35,389,950 (GRCm39) D868G probably damaging Het
Cldn10 T G 14: 119,092,439 (GRCm39) V13G probably benign Het
Cnot6 G T 11: 49,575,941 (GRCm39) Q178K probably benign Het
Crot T C 5: 9,023,629 (GRCm39) I420V probably benign Het
Csgalnact1 T A 8: 68,854,105 (GRCm39) H232L possibly damaging Het
Cuzd1 T C 7: 130,910,626 (GRCm39) I556M possibly damaging Het
Cyp2c54 G A 19: 40,026,857 (GRCm39) R433W probably damaging Het
Cyp2j11 A G 4: 96,207,539 (GRCm39) F259L probably benign Het
Dhx9 C T 1: 153,348,922 (GRCm39) G264R probably damaging Het
Dnah5 G A 15: 28,299,245 (GRCm39) V1536M probably benign Het
Erlin1 T A 19: 44,058,041 (GRCm39) probably benign Het
Foxb2 C A 19: 16,850,347 (GRCm39) V220L possibly damaging Het
Gigyf2 A T 1: 87,338,431 (GRCm39) T388S probably benign Het
Gimap5 T C 6: 48,730,068 (GRCm39) C213R probably benign Het
Gkap1 T G 13: 58,386,506 (GRCm39) K57N probably damaging Het
H60b T G 10: 22,159,421 (GRCm39) probably benign Het
Hectd4 C T 5: 121,442,489 (GRCm39) R670* probably null Het
Hoxc9 A G 15: 102,892,341 (GRCm39) N185D probably damaging Het
Igkv1-117 A G 6: 68,098,766 (GRCm39) E105G possibly damaging Het
Klk10 T A 7: 43,432,239 (GRCm39) Y57* probably null Het
Lrrc63 A T 14: 75,363,312 (GRCm39) I273K possibly damaging Het
M6pr T C 6: 122,292,025 (GRCm39) I119T probably damaging Het
Mael T C 1: 166,063,127 (GRCm39) probably null Het
Magi1 A G 6: 93,681,330 (GRCm39) S574P possibly damaging Het
Man2c1 A G 9: 57,044,061 (GRCm39) D291G probably benign Het
Mapk1ip1l A T 14: 47,547,920 (GRCm39) probably benign Het
Mrc2 A G 11: 105,238,132 (GRCm39) T1135A possibly damaging Het
Mrpl39 A G 16: 84,527,736 (GRCm39) V164A probably benign Het
Mynn C A 3: 30,661,290 (GRCm39) P124H probably damaging Het
Or11l3 T G 11: 58,516,800 (GRCm39) Q23P probably damaging Het
Or14n1-ps1 A T 7: 86,093,062 (GRCm39) N291I probably damaging Het
Or2k2 A G 4: 58,785,203 (GRCm39) I173T probably damaging Het
Or2t48 A G 11: 58,420,329 (GRCm39) F161S possibly damaging Het
Or6k2 A G 1: 173,986,614 (GRCm39) I92V probably damaging Het
Pcif1 A G 2: 164,726,303 (GRCm39) N68S probably damaging Het
Pcm1 T A 8: 41,728,976 (GRCm39) N649K probably damaging Het
Pira1 T C 7: 3,740,432 (GRCm39) Q263R probably benign Het
Plxna2 T A 1: 194,476,266 (GRCm39) I1162N probably damaging Het
Pnp2 T A 14: 51,201,842 (GRCm39) L276Q probably damaging Het
Sirpb1c T A 3: 15,902,526 (GRCm39) I18F possibly damaging Het
Slc2a12 A T 10: 22,540,678 (GRCm39) M178L probably damaging Het
Slc35c1 G T 2: 92,285,052 (GRCm39) F187L probably benign Het
Smg1 T C 7: 117,770,982 (GRCm39) probably benign Het
Spmip6 A G 4: 41,505,071 (GRCm39) S214P possibly damaging Het
Spopfm2 T C 3: 94,083,497 (GRCm39) M105V probably benign Het
Stn1 T C 19: 47,490,111 (GRCm39) H342R probably benign Het
Sult1c2 A T 17: 54,276,709 (GRCm39) H117Q probably damaging Het
Thap1 G A 8: 26,650,925 (GRCm39) R42K probably damaging Het
Tpp2 A T 1: 44,016,365 (GRCm39) probably null Het
Trib2 G T 12: 15,865,347 (GRCm39) P76Q probably damaging Het
Ttc24 G T 3: 87,980,369 (GRCm39) Q111K probably damaging Het
Uggt1 A C 1: 36,215,724 (GRCm39) probably null Het
Ugt2b1 A G 5: 87,074,326 (GRCm39) L11S probably damaging Het
Uso1 T G 5: 92,343,222 (GRCm39) S769A probably benign Het
Vmn2r117 T C 17: 23,698,442 (GRCm39) T44A probably benign Het
Vmn2r28 T A 7: 5,489,347 (GRCm39) L497F probably benign Het
Vsig10l G A 7: 43,114,326 (GRCm39) S318N probably benign Het
Wbp4 A G 14: 79,714,263 (GRCm39) L83P probably damaging Het
Wnk1 G A 6: 119,927,044 (GRCm39) R1510W probably damaging Het
Zc3hav1l C T 6: 38,272,176 (GRCm39) V198M probably damaging Het
Zfp1004 A G 2: 150,034,700 (GRCm39) I340M probably benign Het
Other mutations in Ubr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ubr4 APN 4 139,192,633 (GRCm39) missense possibly damaging 0.46
IGL00336:Ubr4 APN 4 139,155,877 (GRCm39) missense probably damaging 1.00
IGL00586:Ubr4 APN 4 139,182,495 (GRCm39) missense possibly damaging 0.95
IGL00659:Ubr4 APN 4 139,148,556 (GRCm39) missense probably damaging 1.00
IGL00766:Ubr4 APN 4 139,168,077 (GRCm39) missense probably damaging 1.00
IGL00819:Ubr4 APN 4 139,203,593 (GRCm39) missense possibly damaging 0.92
IGL00833:Ubr4 APN 4 139,120,470 (GRCm39) critical splice donor site probably null
IGL01126:Ubr4 APN 4 139,129,866 (GRCm39) missense probably benign 0.04
IGL01311:Ubr4 APN 4 139,206,356 (GRCm39) missense possibly damaging 0.66
IGL01349:Ubr4 APN 4 139,208,039 (GRCm39) missense unknown
IGL01388:Ubr4 APN 4 139,187,554 (GRCm39) missense possibly damaging 0.76
IGL01417:Ubr4 APN 4 139,138,111 (GRCm39) missense probably damaging 0.99
IGL01446:Ubr4 APN 4 139,165,351 (GRCm39) splice site probably benign
IGL01449:Ubr4 APN 4 139,140,047 (GRCm39) missense probably damaging 0.98
IGL01545:Ubr4 APN 4 139,170,140 (GRCm39) splice site probably benign
IGL01568:Ubr4 APN 4 139,148,684 (GRCm39) missense probably damaging 1.00
IGL01596:Ubr4 APN 4 139,189,845 (GRCm39) splice site probably benign
IGL01621:Ubr4 APN 4 139,168,094 (GRCm39) nonsense probably null
IGL01639:Ubr4 APN 4 139,144,655 (GRCm39) missense probably damaging 0.99
IGL01655:Ubr4 APN 4 139,135,107 (GRCm39) missense probably damaging 1.00
IGL01710:Ubr4 APN 4 139,145,772 (GRCm39) missense possibly damaging 0.81
IGL01830:Ubr4 APN 4 139,199,811 (GRCm39) missense probably damaging 0.99
IGL01862:Ubr4 APN 4 139,204,469 (GRCm39) missense possibly damaging 0.66
IGL01868:Ubr4 APN 4 139,139,989 (GRCm39) nonsense probably null
IGL01874:Ubr4 APN 4 139,120,600 (GRCm39) splice site probably benign
IGL01889:Ubr4 APN 4 139,189,783 (GRCm39) nonsense probably null
IGL01891:Ubr4 APN 4 139,163,571 (GRCm39) critical splice donor site probably null
IGL01980:Ubr4 APN 4 139,156,913 (GRCm39) missense probably damaging 0.99
IGL02126:Ubr4 APN 4 139,180,052 (GRCm39) critical splice donor site probably null
IGL02153:Ubr4 APN 4 139,187,471 (GRCm39) nonsense probably null
IGL02173:Ubr4 APN 4 139,164,381 (GRCm39) splice site probably null
IGL02214:Ubr4 APN 4 139,155,894 (GRCm39) missense possibly damaging 0.95
IGL02214:Ubr4 APN 4 139,189,138 (GRCm39) critical splice acceptor site probably null
IGL02220:Ubr4 APN 4 139,115,746 (GRCm39) missense probably benign 0.01
IGL02246:Ubr4 APN 4 139,186,414 (GRCm39) missense possibly damaging 0.89
IGL02264:Ubr4 APN 4 139,182,939 (GRCm39) nonsense probably null
IGL02273:Ubr4 APN 4 139,199,889 (GRCm39) missense possibly damaging 0.94
IGL02316:Ubr4 APN 4 139,200,489 (GRCm39) missense possibly damaging 0.46
IGL02328:Ubr4 APN 4 139,206,233 (GRCm39) missense probably damaging 0.97
IGL02476:Ubr4 APN 4 139,148,560 (GRCm39) nonsense probably null
IGL02477:Ubr4 APN 4 139,163,516 (GRCm39) missense probably damaging 0.98
IGL02544:Ubr4 APN 4 139,142,429 (GRCm39) missense probably damaging 1.00
IGL02622:Ubr4 APN 4 139,194,561 (GRCm39) nonsense probably null
IGL02679:Ubr4 APN 4 139,186,445 (GRCm39) missense probably damaging 0.99
IGL02728:Ubr4 APN 4 139,196,122 (GRCm39) missense probably damaging 1.00
IGL02754:Ubr4 APN 4 139,138,095 (GRCm39) missense probably damaging 0.99
IGL02754:Ubr4 APN 4 139,120,470 (GRCm39) critical splice donor site probably null
IGL02892:Ubr4 APN 4 139,144,642 (GRCm39) missense probably damaging 0.96
IGL02897:Ubr4 APN 4 139,199,819 (GRCm39) missense probably damaging 0.97
IGL02946:Ubr4 APN 4 139,152,606 (GRCm39) missense probably damaging 1.00
IGL02964:Ubr4 APN 4 139,135,131 (GRCm39) missense possibly damaging 0.84
IGL03059:Ubr4 APN 4 139,207,987 (GRCm39) missense probably damaging 0.98
IGL03068:Ubr4 APN 4 139,137,041 (GRCm39) missense probably benign 0.02
IGL03087:Ubr4 APN 4 139,177,668 (GRCm39) nonsense probably null
IGL03116:Ubr4 APN 4 139,206,892 (GRCm39) splice site probably benign
IGL03212:Ubr4 APN 4 139,137,074 (GRCm39) missense probably benign 0.13
IGL03228:Ubr4 APN 4 139,156,909 (GRCm39) missense probably damaging 1.00
IGL03292:Ubr4 APN 4 139,167,746 (GRCm39) missense probably damaging 1.00
IGL03388:Ubr4 APN 4 139,142,343 (GRCm39) missense probably damaging 0.98
IGL03393:Ubr4 APN 4 139,179,989 (GRCm39) missense probably damaging 1.00
IGL03409:Ubr4 APN 4 139,127,240 (GRCm39) nonsense probably null
Aqua_regia UTSW 4 139,180,030 (GRCm39) nonsense probably null
Eats UTSW 4 139,190,886 (GRCm39) missense probably damaging 0.97
Hardened UTSW 4 139,196,158 (GRCm39) missense probably damaging 1.00
Stoney UTSW 4 139,171,998 (GRCm39) missense probably damaging 1.00
Uber UTSW 4 139,206,373 (GRCm39) critical splice donor site probably null
BB001:Ubr4 UTSW 4 139,194,587 (GRCm39) missense unknown
BB011:Ubr4 UTSW 4 139,194,587 (GRCm39) missense unknown
P0019:Ubr4 UTSW 4 139,179,092 (GRCm39) missense probably damaging 1.00
PIT4544001:Ubr4 UTSW 4 139,129,871 (GRCm39) missense possibly damaging 0.93
R0001:Ubr4 UTSW 4 139,179,099 (GRCm39) missense probably damaging 1.00
R0002:Ubr4 UTSW 4 139,118,211 (GRCm39) missense probably damaging 1.00
R0006:Ubr4 UTSW 4 139,158,960 (GRCm39) missense probably benign 0.03
R0006:Ubr4 UTSW 4 139,158,960 (GRCm39) missense probably benign 0.03
R0008:Ubr4 UTSW 4 139,157,487 (GRCm39) missense probably damaging 1.00
R0027:Ubr4 UTSW 4 139,127,704 (GRCm39) missense probably damaging 0.99
R0027:Ubr4 UTSW 4 139,127,704 (GRCm39) missense probably damaging 0.99
R0030:Ubr4 UTSW 4 139,154,104 (GRCm39) missense probably damaging 1.00
R0044:Ubr4 UTSW 4 139,164,369 (GRCm39) splice site probably benign
R0044:Ubr4 UTSW 4 139,164,369 (GRCm39) splice site probably benign
R0088:Ubr4 UTSW 4 139,168,125 (GRCm39) missense probably damaging 1.00
R0131:Ubr4 UTSW 4 139,191,362 (GRCm39) missense possibly damaging 0.66
R0184:Ubr4 UTSW 4 139,172,573 (GRCm39) missense probably damaging 1.00
R0219:Ubr4 UTSW 4 139,157,568 (GRCm39) missense possibly damaging 0.64
R0227:Ubr4 UTSW 4 139,158,960 (GRCm39) missense probably benign 0.03
R0270:Ubr4 UTSW 4 139,206,746 (GRCm39) splice site probably benign
R0285:Ubr4 UTSW 4 139,168,112 (GRCm39) missense probably damaging 1.00
R0322:Ubr4 UTSW 4 139,149,729 (GRCm39) missense probably damaging 1.00
R0363:Ubr4 UTSW 4 139,119,171 (GRCm39) missense probably damaging 0.98
R0393:Ubr4 UTSW 4 139,138,171 (GRCm39) splice site probably benign
R0450:Ubr4 UTSW 4 139,157,534 (GRCm39) missense probably benign 0.14
R0504:Ubr4 UTSW 4 139,133,889 (GRCm39) missense probably damaging 1.00
R0504:Ubr4 UTSW 4 139,208,149 (GRCm39) critical splice donor site probably null
R0510:Ubr4 UTSW 4 139,157,534 (GRCm39) missense probably benign 0.14
R0513:Ubr4 UTSW 4 139,144,186 (GRCm39) missense possibly damaging 0.74
R0517:Ubr4 UTSW 4 139,119,435 (GRCm39) missense probably benign 0.00
R0558:Ubr4 UTSW 4 139,154,213 (GRCm39) missense probably benign 0.09
R0617:Ubr4 UTSW 4 139,206,373 (GRCm39) critical splice donor site probably null
R0636:Ubr4 UTSW 4 139,163,613 (GRCm39) splice site probably null
R0637:Ubr4 UTSW 4 139,126,926 (GRCm39) missense probably damaging 1.00
R0652:Ubr4 UTSW 4 139,128,637 (GRCm39) missense probably damaging 0.99
R0691:Ubr4 UTSW 4 139,151,217 (GRCm39) missense probably damaging 1.00
R0729:Ubr4 UTSW 4 139,212,631 (GRCm39) missense possibly damaging 0.66
R0735:Ubr4 UTSW 4 139,155,339 (GRCm39) splice site probably null
R0751:Ubr4 UTSW 4 139,164,509 (GRCm39) splice site probably benign
R0789:Ubr4 UTSW 4 139,137,582 (GRCm39) critical splice donor site probably null
R0825:Ubr4 UTSW 4 139,206,887 (GRCm39) critical splice donor site probably null
R0828:Ubr4 UTSW 4 139,177,864 (GRCm39) splice site probably benign
R1052:Ubr4 UTSW 4 139,182,771 (GRCm39) missense possibly damaging 0.83
R1184:Ubr4 UTSW 4 139,164,509 (GRCm39) splice site probably benign
R1222:Ubr4 UTSW 4 139,115,782 (GRCm39) splice site probably null
R1258:Ubr4 UTSW 4 139,154,225 (GRCm39) missense probably damaging 1.00
R1321:Ubr4 UTSW 4 139,187,434 (GRCm39) missense possibly damaging 0.46
R1385:Ubr4 UTSW 4 139,129,923 (GRCm39) missense probably benign 0.00
R1450:Ubr4 UTSW 4 139,195,339 (GRCm39) missense probably damaging 1.00
R1470:Ubr4 UTSW 4 139,148,537 (GRCm39) splice site probably null
R1470:Ubr4 UTSW 4 139,148,537 (GRCm39) splice site probably null
R1474:Ubr4 UTSW 4 139,156,890 (GRCm39) missense probably damaging 1.00
R1479:Ubr4 UTSW 4 139,153,151 (GRCm39) missense possibly damaging 0.95
R1534:Ubr4 UTSW 4 139,155,462 (GRCm39) missense possibly damaging 0.95
R1546:Ubr4 UTSW 4 139,144,238 (GRCm39) nonsense probably null
R1785:Ubr4 UTSW 4 139,151,256 (GRCm39) missense probably damaging 1.00
R1786:Ubr4 UTSW 4 139,151,256 (GRCm39) missense probably damaging 1.00
R1789:Ubr4 UTSW 4 139,120,364 (GRCm39) missense probably damaging 1.00
R1796:Ubr4 UTSW 4 139,155,907 (GRCm39) missense probably benign 0.25
R1800:Ubr4 UTSW 4 139,135,274 (GRCm39) missense probably damaging 0.99
R1801:Ubr4 UTSW 4 139,179,874 (GRCm39) splice site probably null
R1827:Ubr4 UTSW 4 139,153,008 (GRCm39) critical splice acceptor site probably null
R1887:Ubr4 UTSW 4 139,182,871 (GRCm39) missense probably damaging 1.00
R1966:Ubr4 UTSW 4 139,178,555 (GRCm39) critical splice acceptor site probably null
R2010:Ubr4 UTSW 4 139,207,963 (GRCm39) missense possibly damaging 0.92
R2049:Ubr4 UTSW 4 139,204,518 (GRCm39) missense probably damaging 0.97
R2069:Ubr4 UTSW 4 139,206,851 (GRCm39) missense possibly damaging 0.66
R2114:Ubr4 UTSW 4 139,156,922 (GRCm39) nonsense probably null
R2140:Ubr4 UTSW 4 139,204,518 (GRCm39) missense probably damaging 0.97
R2141:Ubr4 UTSW 4 139,204,518 (GRCm39) missense probably damaging 0.97
R2142:Ubr4 UTSW 4 139,204,518 (GRCm39) missense probably damaging 0.97
R2168:Ubr4 UTSW 4 139,137,960 (GRCm39) missense probably benign 0.25
R2237:Ubr4 UTSW 4 139,170,101 (GRCm39) missense probably damaging 1.00
R2249:Ubr4 UTSW 4 139,176,232 (GRCm39) missense probably damaging 1.00
R2261:Ubr4 UTSW 4 139,140,773 (GRCm39) missense probably damaging 0.99
R2264:Ubr4 UTSW 4 139,147,684 (GRCm39) splice site probably benign
R2353:Ubr4 UTSW 4 139,160,984 (GRCm39) missense possibly damaging 0.48
R2437:Ubr4 UTSW 4 139,200,853 (GRCm39) missense possibly damaging 0.90
R2496:Ubr4 UTSW 4 139,200,516 (GRCm39) unclassified probably benign
R2896:Ubr4 UTSW 4 139,182,955 (GRCm39) splice site probably null
R2922:Ubr4 UTSW 4 139,206,811 (GRCm39) missense possibly damaging 0.66
R2972:Ubr4 UTSW 4 139,133,847 (GRCm39) missense probably benign 0.22
R2973:Ubr4 UTSW 4 139,133,847 (GRCm39) missense probably benign 0.22
R2989:Ubr4 UTSW 4 139,190,869 (GRCm39) missense possibly damaging 0.89
R3176:Ubr4 UTSW 4 139,149,166 (GRCm39) missense probably benign 0.03
R3276:Ubr4 UTSW 4 139,149,166 (GRCm39) missense probably benign 0.03
R3772:Ubr4 UTSW 4 139,180,011 (GRCm39) missense possibly damaging 0.89
R3844:Ubr4 UTSW 4 139,186,437 (GRCm39) missense probably damaging 0.99
R3873:Ubr4 UTSW 4 139,151,301 (GRCm39) missense probably damaging 1.00
R3900:Ubr4 UTSW 4 139,206,373 (GRCm39) critical splice donor site probably null
R3951:Ubr4 UTSW 4 139,120,405 (GRCm39) missense probably damaging 1.00
R4020:Ubr4 UTSW 4 139,179,116 (GRCm39) missense probably damaging 0.98
R4178:Ubr4 UTSW 4 139,120,725 (GRCm39) missense probably damaging 1.00
R4308:Ubr4 UTSW 4 139,199,820 (GRCm39) missense possibly damaging 0.46
R4378:Ubr4 UTSW 4 139,137,751 (GRCm39) missense possibly damaging 0.76
R4400:Ubr4 UTSW 4 139,189,167 (GRCm39) missense possibly damaging 0.66
R4421:Ubr4 UTSW 4 139,189,167 (GRCm39) missense possibly damaging 0.66
R4462:Ubr4 UTSW 4 139,145,813 (GRCm39) missense possibly damaging 0.47
R4583:Ubr4 UTSW 4 139,108,164 (GRCm39) missense possibly damaging 0.82
R4611:Ubr4 UTSW 4 139,126,890 (GRCm39) missense possibly damaging 0.93
R4664:Ubr4 UTSW 4 139,133,829 (GRCm39) missense possibly damaging 0.56
R4671:Ubr4 UTSW 4 139,163,502 (GRCm39) missense possibly damaging 0.66
R4672:Ubr4 UTSW 4 139,138,027 (GRCm39) missense probably damaging 0.99
R4673:Ubr4 UTSW 4 139,138,027 (GRCm39) missense probably damaging 0.99
R4696:Ubr4 UTSW 4 139,135,983 (GRCm39) missense probably benign 0.09
R4701:Ubr4 UTSW 4 139,198,647 (GRCm39) missense possibly damaging 0.66
R4705:Ubr4 UTSW 4 139,177,840 (GRCm39) missense probably damaging 1.00
R4726:Ubr4 UTSW 4 139,209,890 (GRCm39) missense possibly damaging 0.46
R4728:Ubr4 UTSW 4 139,151,190 (GRCm39) missense probably damaging 1.00
R4783:Ubr4 UTSW 4 139,149,044 (GRCm39) missense possibly damaging 0.85
R4833:Ubr4 UTSW 4 139,129,857 (GRCm39) missense probably damaging 0.98
R4892:Ubr4 UTSW 4 139,155,828 (GRCm39) missense probably benign 0.14
R4936:Ubr4 UTSW 4 139,123,877 (GRCm39) missense probably damaging 0.98
R5000:Ubr4 UTSW 4 139,163,480 (GRCm39) missense probably damaging 0.98
R5114:Ubr4 UTSW 4 139,137,934 (GRCm39) missense probably damaging 0.99
R5189:Ubr4 UTSW 4 139,137,960 (GRCm39) missense probably benign 0.25
R5197:Ubr4 UTSW 4 139,195,408 (GRCm39) missense probably damaging 1.00
R5213:Ubr4 UTSW 4 139,129,877 (GRCm39) nonsense probably null
R5219:Ubr4 UTSW 4 139,204,543 (GRCm39) nonsense probably null
R5346:Ubr4 UTSW 4 139,155,802 (GRCm39) missense probably damaging 0.97
R5368:Ubr4 UTSW 4 139,124,839 (GRCm39) intron probably benign
R5442:Ubr4 UTSW 4 139,135,083 (GRCm39) missense probably damaging 1.00
R5527:Ubr4 UTSW 4 139,208,099 (GRCm39) missense possibly damaging 0.83
R5548:Ubr4 UTSW 4 139,187,401 (GRCm39) missense probably damaging 0.97
R5568:Ubr4 UTSW 4 139,119,349 (GRCm39) missense probably damaging 0.99
R5639:Ubr4 UTSW 4 139,179,959 (GRCm39) missense possibly damaging 0.66
R5643:Ubr4 UTSW 4 139,171,998 (GRCm39) missense probably damaging 1.00
R5663:Ubr4 UTSW 4 139,155,894 (GRCm39) missense possibly damaging 0.95
R5755:Ubr4 UTSW 4 139,187,406 (GRCm39) missense possibly damaging 0.66
R5781:Ubr4 UTSW 4 139,195,407 (GRCm39) missense probably damaging 1.00
R5784:Ubr4 UTSW 4 139,152,529 (GRCm39) missense probably damaging 1.00
R5817:Ubr4 UTSW 4 139,196,158 (GRCm39) missense probably damaging 1.00
R5872:Ubr4 UTSW 4 139,152,641 (GRCm39) missense probably damaging 0.98
R5891:Ubr4 UTSW 4 139,135,937 (GRCm39) nonsense probably null
R5901:Ubr4 UTSW 4 139,178,565 (GRCm39) missense probably damaging 1.00
R5958:Ubr4 UTSW 4 139,182,949 (GRCm39) missense probably damaging 1.00
R5974:Ubr4 UTSW 4 139,148,389 (GRCm39) splice site probably null
R6065:Ubr4 UTSW 4 139,148,549 (GRCm39) missense probably damaging 1.00
R6109:Ubr4 UTSW 4 139,144,675 (GRCm39) missense probably damaging 0.99
R6207:Ubr4 UTSW 4 139,148,559 (GRCm39) missense probably damaging 1.00
R6265:Ubr4 UTSW 4 139,179,951 (GRCm39) missense possibly damaging 0.90
R6319:Ubr4 UTSW 4 139,136,200 (GRCm39) missense possibly damaging 0.84
R6342:Ubr4 UTSW 4 139,156,850 (GRCm39) missense possibly damaging 0.88
R6434:Ubr4 UTSW 4 139,156,949 (GRCm39) missense probably damaging 1.00
R6437:Ubr4 UTSW 4 139,124,525 (GRCm39) critical splice donor site probably null
R6481:Ubr4 UTSW 4 139,159,062 (GRCm39) missense probably damaging 0.97
R6502:Ubr4 UTSW 4 139,171,982 (GRCm39) missense probably damaging 1.00
R6546:Ubr4 UTSW 4 139,141,705 (GRCm39) missense probably damaging 0.99
R6603:Ubr4 UTSW 4 139,182,897 (GRCm39) missense probably benign 0.17
R6648:Ubr4 UTSW 4 139,180,030 (GRCm39) nonsense probably null
R6649:Ubr4 UTSW 4 139,200,935 (GRCm39) missense possibly damaging 0.66
R6653:Ubr4 UTSW 4 139,200,935 (GRCm39) missense possibly damaging 0.66
R6668:Ubr4 UTSW 4 139,192,652 (GRCm39) missense probably damaging 1.00
R6770:Ubr4 UTSW 4 139,216,493 (GRCm39) missense unknown
R6772:Ubr4 UTSW 4 139,194,541 (GRCm39) nonsense probably null
R6857:Ubr4 UTSW 4 139,213,362 (GRCm39) missense possibly damaging 0.90
R6869:Ubr4 UTSW 4 139,194,538 (GRCm39) missense possibly damaging 0.93
R6912:Ubr4 UTSW 4 139,185,545 (GRCm39) critical splice donor site probably null
R6943:Ubr4 UTSW 4 139,164,442 (GRCm39) nonsense probably null
R6970:Ubr4 UTSW 4 139,133,839 (GRCm39) nonsense probably null
R6976:Ubr4 UTSW 4 139,120,388 (GRCm39) missense probably damaging 0.98
R7000:Ubr4 UTSW 4 139,141,715 (GRCm39) missense probably damaging 1.00
R7017:Ubr4 UTSW 4 139,120,401 (GRCm39) missense probably damaging 0.99
R7165:Ubr4 UTSW 4 139,177,824 (GRCm39) missense
R7222:Ubr4 UTSW 4 139,190,684 (GRCm39) missense unknown
R7241:Ubr4 UTSW 4 139,170,725 (GRCm39) missense probably damaging 1.00
R7343:Ubr4 UTSW 4 139,140,749 (GRCm39) missense probably benign 0.09
R7367:Ubr4 UTSW 4 139,180,002 (GRCm39) missense unknown
R7393:Ubr4 UTSW 4 139,154,096 (GRCm39) missense probably damaging 1.00
R7432:Ubr4 UTSW 4 139,115,693 (GRCm39) missense probably damaging 1.00
R7448:Ubr4 UTSW 4 139,189,778 (GRCm39) missense unknown
R7502:Ubr4 UTSW 4 139,139,983 (GRCm39) missense possibly damaging 0.72
R7514:Ubr4 UTSW 4 139,179,966 (GRCm39) missense unknown
R7526:Ubr4 UTSW 4 139,149,728 (GRCm39) missense probably benign 0.00
R7529:Ubr4 UTSW 4 139,149,728 (GRCm39) missense probably benign 0.00
R7666:Ubr4 UTSW 4 139,140,791 (GRCm39) missense possibly damaging 0.81
R7699:Ubr4 UTSW 4 139,136,178 (GRCm39) nonsense probably null
R7700:Ubr4 UTSW 4 139,136,178 (GRCm39) nonsense probably null
R7726:Ubr4 UTSW 4 139,186,231 (GRCm39) missense unknown
R7753:Ubr4 UTSW 4 139,197,603 (GRCm39) missense unknown
R7810:Ubr4 UTSW 4 139,142,394 (GRCm39) missense
R7837:Ubr4 UTSW 4 139,120,462 (GRCm39) nonsense probably null
R7868:Ubr4 UTSW 4 139,187,344 (GRCm39) missense unknown
R7872:Ubr4 UTSW 4 139,120,373 (GRCm39) missense possibly damaging 0.94
R7887:Ubr4 UTSW 4 139,135,121 (GRCm39) missense probably damaging 0.99
R7924:Ubr4 UTSW 4 139,194,587 (GRCm39) missense unknown
R7980:Ubr4 UTSW 4 139,145,717 (GRCm39) missense
R7982:Ubr4 UTSW 4 139,155,519 (GRCm39) critical splice donor site probably null
R8005:Ubr4 UTSW 4 139,139,941 (GRCm39) missense probably damaging 0.98
R8054:Ubr4 UTSW 4 139,195,413 (GRCm39) missense unknown
R8094:Ubr4 UTSW 4 139,168,007 (GRCm39) missense probably damaging 0.97
R8151:Ubr4 UTSW 4 139,130,112 (GRCm39) missense probably damaging 0.97
R8183:Ubr4 UTSW 4 139,209,782 (GRCm39) missense unknown
R8252:Ubr4 UTSW 4 139,200,528 (GRCm39) missense unknown
R8505:Ubr4 UTSW 4 139,156,880 (GRCm39) missense
R8716:Ubr4 UTSW 4 139,196,164 (GRCm39) missense unknown
R8720:Ubr4 UTSW 4 139,208,149 (GRCm39) critical splice donor site probably null
R8749:Ubr4 UTSW 4 139,129,935 (GRCm39) missense probably damaging 0.98
R8768:Ubr4 UTSW 4 139,149,076 (GRCm39) missense
R8789:Ubr4 UTSW 4 139,137,494 (GRCm39) missense possibly damaging 0.76
R8879:Ubr4 UTSW 4 139,137,829 (GRCm39) missense probably benign 0.06
R8937:Ubr4 UTSW 4 139,190,886 (GRCm39) missense probably damaging 0.97
R9006:Ubr4 UTSW 4 139,172,003 (GRCm39) critical splice donor site probably null
R9116:Ubr4 UTSW 4 139,145,785 (GRCm39) missense
R9134:Ubr4 UTSW 4 139,127,755 (GRCm39) critical splice donor site probably null
R9251:Ubr4 UTSW 4 139,177,636 (GRCm39) missense
R9340:Ubr4 UTSW 4 139,182,763 (GRCm39) missense unknown
R9384:Ubr4 UTSW 4 139,194,631 (GRCm39) missense unknown
R9389:Ubr4 UTSW 4 139,153,235 (GRCm39) missense
R9393:Ubr4 UTSW 4 139,212,613 (GRCm39) missense unknown
R9531:Ubr4 UTSW 4 139,135,217 (GRCm39) missense probably benign 0.00
R9573:Ubr4 UTSW 4 139,148,450 (GRCm39) missense
R9604:Ubr4 UTSW 4 139,159,827 (GRCm39) critical splice donor site probably null
R9613:Ubr4 UTSW 4 139,149,073 (GRCm39) missense
R9623:Ubr4 UTSW 4 139,159,024 (GRCm39) missense probably benign 0.00
R9651:Ubr4 UTSW 4 139,206,859 (GRCm39) missense unknown
R9685:Ubr4 UTSW 4 139,191,341 (GRCm39) missense unknown
R9698:Ubr4 UTSW 4 139,167,975 (GRCm39) missense
R9700:Ubr4 UTSW 4 139,119,388 (GRCm39) missense probably damaging 0.97
R9727:Ubr4 UTSW 4 139,140,735 (GRCm39) missense probably damaging 0.98
R9766:Ubr4 UTSW 4 139,194,595 (GRCm39) missense unknown
T0975:Ubr4 UTSW 4 139,179,092 (GRCm39) missense probably damaging 1.00
X0028:Ubr4 UTSW 4 139,137,582 (GRCm39) critical splice donor site probably null
Z1176:Ubr4 UTSW 4 139,137,456 (GRCm39) missense probably damaging 1.00
Z1176:Ubr4 UTSW 4 139,129,971 (GRCm39) missense probably benign 0.04
Z1176:Ubr4 UTSW 4 139,127,696 (GRCm39) missense probably damaging 1.00
Z1177:Ubr4 UTSW 4 139,177,792 (GRCm39) missense
Z1186:Ubr4 UTSW 4 139,137,964 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGTTCTTCAGAGGCAGTCG -3'
(R):5'- CATCATGATCTGCACCAGCTC -3'

Sequencing Primer
(F):5'- TCGGGAGGGCTCTGAACTG -3'
(R):5'- TCCCCACTGCAAGGTGAG -3'
Posted On 2021-01-18