Incidental Mutation 'R8519:Csgalnact1'
ID 658538
Institutional Source Beutler Lab
Gene Symbol Csgalnact1
Ensembl Gene ENSMUSG00000036356
Gene Name chondroitin sulfate N-acetylgalactosaminyltransferase 1
Synonyms CSGalNAcT-1, 4732435N03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R8519 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 68356781-68735146 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 68401453 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 232 (H232L)
Ref Sequence ENSEMBL: ENSMUSP00000116134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078350] [ENSMUST00000130214] [ENSMUST00000136060]
AlphaFold Q8BJQ9
Predicted Effect possibly damaging
Transcript: ENSMUST00000078350
AA Change: H232L

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077459
Gene: ENSMUSG00000036356
AA Change: H232L

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:CHGN 55 505 3.5e-85 PFAM
Pfam:Glyco_tranf_2_2 263 478 3.2e-10 PFAM
Pfam:Glyco_transf_7C 409 478 1.7e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130214
AA Change: H232L

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119817
Gene: ENSMUSG00000036356
AA Change: H232L

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:CHGN 71 505 1.1e-59 PFAM
Pfam:Glyco_tranf_2_2 263 478 3.6e-10 PFAM
Pfam:Glyco_transf_7C 405 478 3.4e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000136060
AA Change: H232L

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116134
Gene: ENSMUSG00000036356
AA Change: H232L

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:CHGN 66 300 1.6e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and length, short limbs, and abnormal cartilage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A G 4: 41,505,071 S214P possibly damaging Het
3632451O06Rik T C 14: 49,773,236 D338G probably damaging Het
Adamts14 T C 10: 61,202,840 T964A possibly damaging Het
Adamts7 G A 9: 90,193,557 W1156* probably null Het
Adcy9 T C 16: 4,288,128 I1041V possibly damaging Het
Art4 C A 6: 136,854,351 probably null Het
Bcl9 A G 3: 97,209,018 S787P probably benign Het
Bptf T C 11: 107,061,764 T2088A probably damaging Het
Cdc45 T C 16: 18,808,847 N76S probably damaging Het
Cdon A G 9: 35,478,654 D868G probably damaging Het
Cldn10 T G 14: 118,855,027 V13G probably benign Het
Cnot6 G T 11: 49,685,114 Q178K probably benign Het
Crot T C 5: 8,973,629 I420V probably benign Het
Cuzd1 T C 7: 131,308,897 I556M possibly damaging Het
Cyp2c54 G A 19: 40,038,413 R433W probably damaging Het
Cyp2j11 A G 4: 96,319,302 F259L probably benign Het
Dhx9 C T 1: 153,473,176 G264R probably damaging Het
Dnah5 G A 15: 28,299,099 V1536M probably benign Het
Erlin1 T A 19: 44,069,602 probably benign Het
Foxb2 C A 19: 16,872,983 V220L possibly damaging Het
Gigyf2 A T 1: 87,410,709 T388S probably benign Het
Gimap5 T C 6: 48,753,134 C213R probably benign Het
Gkap1 T G 13: 58,238,692 K57N probably damaging Het
Gm10696 T C 3: 94,176,190 M105V probably benign Het
Gm14139 A G 2: 150,192,780 I340M probably benign Het
Gm15922 T C 7: 3,737,433 Q263R probably benign Het
H60b T G 10: 22,283,522 probably benign Het
Hectd4 C T 5: 121,304,426 R670* probably null Het
Hoxc9 A G 15: 102,983,909 N185D probably damaging Het
Igkv1-117 A G 6: 68,121,782 E105G possibly damaging Het
Klk10 T A 7: 43,782,815 Y57* probably null Het
Lrrc63 A T 14: 75,125,872 I273K possibly damaging Het
M6pr T C 6: 122,315,066 I119T probably damaging Het
Mael T C 1: 166,235,558 probably null Het
Magi1 A G 6: 93,704,349 S574P possibly damaging Het
Man2c1 A G 9: 57,136,777 D291G probably benign Het
Mapk1ip1l A T 14: 47,310,463 probably benign Het
Mrc2 A G 11: 105,347,306 T1135A possibly damaging Het
Mrpl39 A G 16: 84,730,848 V164A probably benign Het
Mynn C A 3: 30,607,141 P124H probably damaging Het
Olfr267 A G 4: 58,785,203 I173T probably damaging Het
Olfr300-ps1 A T 7: 86,443,854 N291I probably damaging Het
Olfr323 T G 11: 58,625,974 Q23P probably damaging Het
Olfr330 A G 11: 58,529,503 F161S possibly damaging Het
Olfr420 A G 1: 174,159,048 I92V probably damaging Het
Pcif1 A G 2: 164,884,383 N68S probably damaging Het
Pcm1 T A 8: 41,275,939 N649K probably damaging Het
Plxna2 T A 1: 194,793,958 I1162N probably damaging Het
Pnp2 T A 14: 50,964,385 L276Q probably damaging Het
Sirpb1c T A 3: 15,848,362 I18F possibly damaging Het
Slc2a12 A T 10: 22,664,779 M178L probably damaging Het
Slc35c1 G T 2: 92,454,707 F187L probably benign Het
Smg1 T C 7: 118,171,759 probably benign Het
Stn1 T C 19: 47,501,672 H342R probably benign Het
Sult1c1 A T 17: 53,969,681 H117Q probably damaging Het
Thap1 G A 8: 26,160,897 R42K probably damaging Het
Tpp2 A T 1: 43,977,205 probably null Het
Trib2 G T 12: 15,815,346 P76Q probably damaging Het
Ttc24 G T 3: 88,073,062 Q111K probably damaging Het
Ubr4 T C 4: 139,416,647 S1401P probably damaging Het
Uggt1 A C 1: 36,176,643 probably null Het
Ugt2b1 A G 5: 86,926,467 L11S probably damaging Het
Uso1 T G 5: 92,195,363 S769A probably benign Het
Vmn2r117 T C 17: 23,479,468 T44A probably benign Het
Vmn2r28 T A 7: 5,486,348 L497F probably benign Het
Vsig10l G A 7: 43,464,902 S318N probably benign Het
Wbp4 A G 14: 79,476,823 L83P probably damaging Het
Wnk1 G A 6: 119,950,083 R1510W probably damaging Het
Zc3hav1l C T 6: 38,295,241 V198M probably damaging Het
Other mutations in Csgalnact1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02015:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02025:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02037:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02059:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02074:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02079:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02080:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02094:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02127:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02128:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02157:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02158:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02197:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02201:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02206:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02207:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02214:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02215:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02229:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02243:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02247:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02248:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02250:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02389:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02394:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02397:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02398:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02400:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02404:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02405:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02406:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02420:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02425:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02428:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02436:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02437:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02438:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02468:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02470:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02472:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02473:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02474:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02475:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02510:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02529:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02530:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02531:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02533:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02543:Csgalnact1 APN 8 68461068 missense probably damaging 1.00
IGL02620:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02625:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02671:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02674:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02683:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02685:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02686:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02697:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02698:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02741:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02985:Csgalnact1 APN 8 68461043 missense probably benign 0.02
R0173:Csgalnact1 UTSW 8 68461029 missense probably damaging 1.00
R1594:Csgalnact1 UTSW 8 68358632 missense probably damaging 1.00
R1655:Csgalnact1 UTSW 8 68373689 missense possibly damaging 0.89
R1873:Csgalnact1 UTSW 8 68401384 missense probably benign 0.02
R1955:Csgalnact1 UTSW 8 68372667 missense probably benign
R2421:Csgalnact1 UTSW 8 68461508 missense probably benign 0.42
R3195:Csgalnact1 UTSW 8 68461085 frame shift probably null
R3196:Csgalnact1 UTSW 8 68461085 frame shift probably null
R3951:Csgalnact1 UTSW 8 68461262 missense probably benign
R4304:Csgalnact1 UTSW 8 68372642 missense possibly damaging 0.94
R4989:Csgalnact1 UTSW 8 68460971 missense probably benign 0.01
R5133:Csgalnact1 UTSW 8 68460971 missense probably benign 0.01
R5134:Csgalnact1 UTSW 8 68460971 missense probably benign 0.01
R5503:Csgalnact1 UTSW 8 68461473 missense probably damaging 0.98
R5812:Csgalnact1 UTSW 8 68401384 missense probably benign 0.02
R6143:Csgalnact1 UTSW 8 68373550 missense probably damaging 1.00
R6387:Csgalnact1 UTSW 8 68358713 missense probably damaging 1.00
R6476:Csgalnact1 UTSW 8 68461109 missense probably damaging 1.00
R6476:Csgalnact1 UTSW 8 68461110 missense probably damaging 1.00
R7023:Csgalnact1 UTSW 8 68358429 missense probably benign
R8318:Csgalnact1 UTSW 8 68461133 missense probably damaging 1.00
R8446:Csgalnact1 UTSW 8 68461091 missense probably damaging 0.99
R8674:Csgalnact1 UTSW 8 68373616 missense possibly damaging 0.91
R8782:Csgalnact1 UTSW 8 68358655 missense probably damaging 1.00
R9210:Csgalnact1 UTSW 8 68461589 start gained probably benign
Z1088:Csgalnact1 UTSW 8 68401330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCACAATGTCTGGAAAAGGAC -3'
(R):5'- AAGCATTCCCTGTGGTTTTATGAG -3'

Sequencing Primer
(F):5'- TGTCTGGAAAAGGACAGGGCAC -3'
(R):5'- CTGATGGGTTTATATCTCTTTTGGAC -3'
Posted On 2021-01-18