Mutagenetix > Incidental Mutation

Incidental Mutation 'R8519:Csgalnact1'

658538

Institutional Source

Beutler Lab

Gene Symbol

Csgalnact1

Ensembl Gene

ENSMUSG00000036356

Gene Name

chondroitin sulfate N-acetylgalactosaminyltransferase 1

Synonyms

CSGalNAcT-1, 4732435N03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R8519 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

68356781-68735146 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 68401453 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 232 (H232L)

Ref Sequence

ENSEMBL: ENSMUSP00000116134 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078350] [ENSMUST00000130214] [ENSMUST00000136060]

AlphaFold

Q8BJQ9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078350
AA Change: H232L

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000077459
Gene: ENSMUSG00000036356
AA Change: H232L

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
Pfam:CHGN	55	505	3.5e-85	PFAM
Pfam:Glyco_tranf_2_2	263	478	3.2e-10	PFAM
Pfam:Glyco_transf_7C	409	478	1.7e-12	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000130214
AA Change: H232L

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000119817
Gene: ENSMUSG00000036356
AA Change: H232L

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
Pfam:CHGN	71	505	1.1e-59	PFAM
Pfam:Glyco_tranf_2_2	263	478	3.6e-10	PFAM
Pfam:Glyco_transf_7C	405	478	3.4e-12	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000136060
AA Change: H232L

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000116134
Gene: ENSMUSG00000036356
AA Change: H232L

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
Pfam:CHGN	66	300	1.6e-11	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (67/67)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and length, short limbs, and abnormal cartilage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	A	G	4: 41,505,071	S214P	possibly damaging	Het
3632451O06Rik	T	C	14: 49,773,236	D338G	probably damaging	Het
Adamts14	T	C	10: 61,202,840	T964A	possibly damaging	Het
Adamts7	G	A	9: 90,193,557	W1156*	probably null	Het
Adcy9	T	C	16: 4,288,128	I1041V	possibly damaging	Het
Art4	C	A	6: 136,854,351		probably null	Het
Bcl9	A	G	3: 97,209,018	S787P	probably benign	Het
Bptf	T	C	11: 107,061,764	T2088A	probably damaging	Het
Cdc45	T	C	16: 18,808,847	N76S	probably damaging	Het
Cdon	A	G	9: 35,478,654	D868G	probably damaging	Het
Cldn10	T	G	14: 118,855,027	V13G	probably benign	Het
Cnot6	G	T	11: 49,685,114	Q178K	probably benign	Het
Crot	T	C	5: 8,973,629	I420V	probably benign	Het
Cuzd1	T	C	7: 131,308,897	I556M	possibly damaging	Het
Cyp2c54	G	A	19: 40,038,413	R433W	probably damaging	Het
Cyp2j11	A	G	4: 96,319,302	F259L	probably benign	Het
Dhx9	C	T	1: 153,473,176	G264R	probably damaging	Het
Dnah5	G	A	15: 28,299,099	V1536M	probably benign	Het
Erlin1	T	A	19: 44,069,602		probably benign	Het
Foxb2	C	A	19: 16,872,983	V220L	possibly damaging	Het
Gigyf2	A	T	1: 87,410,709	T388S	probably benign	Het
Gimap5	T	C	6: 48,753,134	C213R	probably benign	Het
Gkap1	T	G	13: 58,238,692	K57N	probably damaging	Het
Gm10696	T	C	3: 94,176,190	M105V	probably benign	Het
Gm14139	A	G	2: 150,192,780	I340M	probably benign	Het
Gm15922	T	C	7: 3,737,433	Q263R	probably benign	Het
H60b	T	G	10: 22,283,522		probably benign	Het
Hectd4	C	T	5: 121,304,426	R670*	probably null	Het
Hoxc9	A	G	15: 102,983,909	N185D	probably damaging	Het
Igkv1-117	A	G	6: 68,121,782	E105G	possibly damaging	Het
Klk10	T	A	7: 43,782,815	Y57*	probably null	Het
Lrrc63	A	T	14: 75,125,872	I273K	possibly damaging	Het
M6pr	T	C	6: 122,315,066	I119T	probably damaging	Het
Mael	T	C	1: 166,235,558		probably null	Het
Magi1	A	G	6: 93,704,349	S574P	possibly damaging	Het
Man2c1	A	G	9: 57,136,777	D291G	probably benign	Het
Mapk1ip1l	A	T	14: 47,310,463		probably benign	Het
Mrc2	A	G	11: 105,347,306	T1135A	possibly damaging	Het
Mrpl39	A	G	16: 84,730,848	V164A	probably benign	Het
Mynn	C	A	3: 30,607,141	P124H	probably damaging	Het
Olfr267	A	G	4: 58,785,203	I173T	probably damaging	Het
Olfr300-ps1	A	T	7: 86,443,854	N291I	probably damaging	Het
Olfr323	T	G	11: 58,625,974	Q23P	probably damaging	Het
Olfr330	A	G	11: 58,529,503	F161S	possibly damaging	Het
Olfr420	A	G	1: 174,159,048	I92V	probably damaging	Het
Pcif1	A	G	2: 164,884,383	N68S	probably damaging	Het
Pcm1	T	A	8: 41,275,939	N649K	probably damaging	Het
Plxna2	T	A	1: 194,793,958	I1162N	probably damaging	Het
Pnp2	T	A	14: 50,964,385	L276Q	probably damaging	Het
Sirpb1c	T	A	3: 15,848,362	I18F	possibly damaging	Het
Slc2a12	A	T	10: 22,664,779	M178L	probably damaging	Het
Slc35c1	G	T	2: 92,454,707	F187L	probably benign	Het
Smg1	T	C	7: 118,171,759		probably benign	Het
Stn1	T	C	19: 47,501,672	H342R	probably benign	Het
Sult1c1	A	T	17: 53,969,681	H117Q	probably damaging	Het
Thap1	G	A	8: 26,160,897	R42K	probably damaging	Het
Tpp2	A	T	1: 43,977,205		probably null	Het
Trib2	G	T	12: 15,815,346	P76Q	probably damaging	Het
Ttc24	G	T	3: 88,073,062	Q111K	probably damaging	Het
Ubr4	T	C	4: 139,416,647	S1401P	probably damaging	Het
Uggt1	A	C	1: 36,176,643		probably null	Het
Ugt2b1	A	G	5: 86,926,467	L11S	probably damaging	Het
Uso1	T	G	5: 92,195,363	S769A	probably benign	Het
Vmn2r117	T	C	17: 23,479,468	T44A	probably benign	Het
Vmn2r28	T	A	7: 5,486,348	L497F	probably benign	Het
Vsig10l	G	A	7: 43,464,902	S318N	probably benign	Het
Wbp4	A	G	14: 79,476,823	L83P	probably damaging	Het
Wnk1	G	A	6: 119,950,083	R1510W	probably damaging	Het
Zc3hav1l	C	T	6: 38,295,241	V198M	probably damaging	Het

Other mutations in Csgalnact1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02015:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02025:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02037:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02059:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02074:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02079:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02080:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02094:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02127:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02128:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02157:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02158:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02197:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02201:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02206:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02207:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02214:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02215:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02229:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02243:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02247:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02248:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02250:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02389:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02394:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02397:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02398:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02400:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02404:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02405:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02406:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02420:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02425:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02428:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02436:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02437:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02438:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02468:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02470:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02472:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02473:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02474:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02475:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02510:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02529:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02530:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02531:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02533:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02543:Csgalnact1	APN	8	68461068	missense	probably damaging	1.00
IGL02620:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02625:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02671:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02674:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02683:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02685:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02686:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02697:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02698:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02741:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02985:Csgalnact1	APN	8	68461043	missense	probably benign	0.02
R0173:Csgalnact1	UTSW	8	68461029	missense	probably damaging	1.00
R1594:Csgalnact1	UTSW	8	68358632	missense	probably damaging	1.00
R1655:Csgalnact1	UTSW	8	68373689	missense	possibly damaging	0.89
R1873:Csgalnact1	UTSW	8	68401384	missense	probably benign	0.02
R1955:Csgalnact1	UTSW	8	68372667	missense	probably benign
R2421:Csgalnact1	UTSW	8	68461508	missense	probably benign	0.42
R3195:Csgalnact1	UTSW	8	68461085	frame shift	probably null
R3196:Csgalnact1	UTSW	8	68461085	frame shift	probably null
R3951:Csgalnact1	UTSW	8	68461262	missense	probably benign
R4304:Csgalnact1	UTSW	8	68372642	missense	possibly damaging	0.94
R4989:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5133:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5134:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5503:Csgalnact1	UTSW	8	68461473	missense	probably damaging	0.98
R5812:Csgalnact1	UTSW	8	68401384	missense	probably benign	0.02
R6143:Csgalnact1	UTSW	8	68373550	missense	probably damaging	1.00
R6387:Csgalnact1	UTSW	8	68358713	missense	probably damaging	1.00
R6476:Csgalnact1	UTSW	8	68461109	missense	probably damaging	1.00
R6476:Csgalnact1	UTSW	8	68461110	missense	probably damaging	1.00
R7023:Csgalnact1	UTSW	8	68358429	missense	probably benign
R8318:Csgalnact1	UTSW	8	68461133	missense	probably damaging	1.00
R8446:Csgalnact1	UTSW	8	68461091	missense	probably damaging	0.99
R8674:Csgalnact1	UTSW	8	68373616	missense	possibly damaging	0.91
R8782:Csgalnact1	UTSW	8	68358655	missense	probably damaging	1.00
R9210:Csgalnact1	UTSW	8	68461589	start gained	probably benign
R9619:Csgalnact1	UTSW	8	68401354	missense	probably damaging	0.99
Z1088:Csgalnact1	UTSW	8	68401330	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCACAATGTCTGGAAAAGGAC -3'
(R):5'- AAGCATTCCCTGTGGTTTTATGAG -3'

Sequencing Primer
(F):5'- TGTCTGGAAAAGGACAGGGCAC -3'
(R):5'- CTGATGGGTTTATATCTCTTTTGGAC -3'

Posted On

2021-01-18