Mutagenetix > Incidental Mutation

Incidental Mutation 'R8519:Bptf'

658549

Institutional Source

Beutler Lab

Gene Symbol

Bptf

Ensembl Gene

ENSMUSG00000040481

Gene Name

bromodomain PHD finger transcription factor

Synonyms

9430093H17Rik, Falz

MMRRC Submission

Accession Numbers

Genbank: NM_176850; MGI: 2444008

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8519 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

107033081-107132127 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 107061764 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 2088 (T2088A)

Ref Sequence

ENSEMBL: ENSMUSP00000102373 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057892] [ENSMUST00000106762] [ENSMUST00000106763] [ENSMUST00000149486]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000057892
AA Change: T2036A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000052303
Gene: ENSMUSG00000040481
AA Change: T2036A

Domain	Start	End	E-Value	Type
low complexity region	12	44	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
low complexity region	77	119	N/A	INTRINSIC
low complexity region	137	197	N/A	INTRINSIC
low complexity region	202	215	N/A	INTRINSIC
DDT	252	312	2.02e-23	SMART
Pfam:WHIM1	351	400	4.7e-8	PFAM
PHD	404	447	2.23e-11	SMART
coiled coil region	864	894	N/A	INTRINSIC
low complexity region	961	973	N/A	INTRINSIC
low complexity region	987	998	N/A	INTRINSIC
low complexity region	1062	1072	N/A	INTRINSIC
low complexity region	1086	1098	N/A	INTRINSIC
low complexity region	1225	1238	N/A	INTRINSIC
low complexity region	1251	1265	N/A	INTRINSIC
low complexity region	1491	1503	N/A	INTRINSIC
low complexity region	1594	1613	N/A	INTRINSIC
low complexity region	1636	1645	N/A	INTRINSIC
low complexity region	1665	1683	N/A	INTRINSIC
low complexity region	1818	1834	N/A	INTRINSIC
coiled coil region	1908	1936	N/A	INTRINSIC
low complexity region	1941	1957	N/A	INTRINSIC
low complexity region	2051	2061	N/A	INTRINSIC
low complexity region	2092	2107	N/A	INTRINSIC
low complexity region	2115	2128	N/A	INTRINSIC
low complexity region	2175	2197	N/A	INTRINSIC
low complexity region	2227	2252	N/A	INTRINSIC
low complexity region	2275	2312	N/A	INTRINSIC
low complexity region	2336	2355	N/A	INTRINSIC
low complexity region	2361	2378	N/A	INTRINSIC
low complexity region	2390	2420	N/A	INTRINSIC
low complexity region	2430	2463	N/A	INTRINSIC
coiled coil region	2489	2527	N/A	INTRINSIC
coiled coil region	2576	2604	N/A	INTRINSIC
low complexity region	2663	2700	N/A	INTRINSIC
low complexity region	2713	2736	N/A	INTRINSIC
PHD	2744	2791	5.32e-9	SMART
BROMO	2800	2908	5.5e-37	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000106762
AA Change: T2088A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102373
Gene: ENSMUSG00000040481
AA Change: T2088A

Domain	Start	End	E-Value	Type
low complexity region	12	44	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
low complexity region	77	119	N/A	INTRINSIC
low complexity region	137	197	N/A	INTRINSIC
low complexity region	202	215	N/A	INTRINSIC
DDT	252	312	2.02e-23	SMART
Pfam:WHIM1	351	400	4.7e-8	PFAM
PHD	404	447	2.23e-11	SMART
internal_repeat_1	589	642	6.48e-5	PROSPERO
low complexity region	644	654	N/A	INTRINSIC
low complexity region	662	679	N/A	INTRINSIC
coiled coil region	926	956	N/A	INTRINSIC
low complexity region	1013	1025	N/A	INTRINSIC
low complexity region	1039	1050	N/A	INTRINSIC
low complexity region	1114	1124	N/A	INTRINSIC
low complexity region	1138	1150	N/A	INTRINSIC
low complexity region	1277	1290	N/A	INTRINSIC
low complexity region	1303	1317	N/A	INTRINSIC
internal_repeat_1	1387	1440	6.48e-5	PROSPERO
low complexity region	1543	1555	N/A	INTRINSIC
low complexity region	1646	1665	N/A	INTRINSIC
low complexity region	1688	1697	N/A	INTRINSIC
low complexity region	1717	1735	N/A	INTRINSIC
low complexity region	1870	1886	N/A	INTRINSIC
coiled coil region	1960	1988	N/A	INTRINSIC
low complexity region	1993	2009	N/A	INTRINSIC
low complexity region	2103	2113	N/A	INTRINSIC
low complexity region	2144	2159	N/A	INTRINSIC
low complexity region	2167	2180	N/A	INTRINSIC
low complexity region	2227	2249	N/A	INTRINSIC
low complexity region	2279	2304	N/A	INTRINSIC
low complexity region	2327	2364	N/A	INTRINSIC
low complexity region	2388	2407	N/A	INTRINSIC
low complexity region	2413	2430	N/A	INTRINSIC
low complexity region	2442	2472	N/A	INTRINSIC
low complexity region	2482	2515	N/A	INTRINSIC
coiled coil region	2541	2579	N/A	INTRINSIC
coiled coil region	2628	2656	N/A	INTRINSIC
low complexity region	2715	2752	N/A	INTRINSIC
low complexity region	2765	2788	N/A	INTRINSIC
PHD	2796	2843	5.32e-9	SMART
BROMO	2852	2960	5.5e-37	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000106763
AA Change: T2151A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000102374
Gene: ENSMUSG00000040481
AA Change: T2151A

Domain	Start	End	E-Value	Type
low complexity region	12	44	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
low complexity region	77	119	N/A	INTRINSIC
low complexity region	137	197	N/A	INTRINSIC
low complexity region	202	215	N/A	INTRINSIC
DDT	252	312	2.02e-23	SMART
Pfam:WHIM1	351	400	4.9e-8	PFAM
PHD	404	447	2.23e-11	SMART
low complexity region	624	639	N/A	INTRINSIC
low complexity region	707	717	N/A	INTRINSIC
low complexity region	725	742	N/A	INTRINSIC
coiled coil region	989	1019	N/A	INTRINSIC
low complexity region	1076	1088	N/A	INTRINSIC
low complexity region	1102	1113	N/A	INTRINSIC
low complexity region	1177	1187	N/A	INTRINSIC
low complexity region	1201	1213	N/A	INTRINSIC
low complexity region	1340	1353	N/A	INTRINSIC
low complexity region	1366	1380	N/A	INTRINSIC
low complexity region	1606	1618	N/A	INTRINSIC
low complexity region	1709	1728	N/A	INTRINSIC
low complexity region	1751	1760	N/A	INTRINSIC
low complexity region	1780	1798	N/A	INTRINSIC
low complexity region	1933	1949	N/A	INTRINSIC
coiled coil region	2023	2051	N/A	INTRINSIC
low complexity region	2056	2072	N/A	INTRINSIC
low complexity region	2166	2176	N/A	INTRINSIC
low complexity region	2207	2222	N/A	INTRINSIC
low complexity region	2230	2243	N/A	INTRINSIC
low complexity region	2290	2312	N/A	INTRINSIC
low complexity region	2342	2367	N/A	INTRINSIC
low complexity region	2390	2427	N/A	INTRINSIC
low complexity region	2451	2470	N/A	INTRINSIC
low complexity region	2476	2493	N/A	INTRINSIC
low complexity region	2505	2535	N/A	INTRINSIC
low complexity region	2545	2578	N/A	INTRINSIC
coiled coil region	2604	2642	N/A	INTRINSIC
coiled coil region	2691	2719	N/A	INTRINSIC
low complexity region	2778	2815	N/A	INTRINSIC
low complexity region	2828	2851	N/A	INTRINSIC
PHD	2859	2906	5.32e-9	SMART
BROMO	2915	3023	5.5e-37	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000149486
AA Change: T252A

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000122575
Gene: ENSMUSG00000040481
AA Change: T252A

Domain	Start	End	E-Value	Type
coiled coil region	70	98	N/A	INTRINSIC
low complexity region	103	119	N/A	INTRINSIC
low complexity region	171	188	N/A	INTRINSIC
low complexity region	267	277	N/A	INTRINSIC

Meta Mutation Damage Score

0.0609

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by the reactivity of its encoded protein to a monoclonal antibody prepared against brain homogenates from patients with Alzheimer's disease. Analysis of the original protein (fetal Alz-50 reactive clone 1, or FAC1), identified as an 810 aa protein containing a DNA-binding domain and a zinc finger motif, suggested it might play a role in the regulation of transcription. High levels of FAC1 were detected in fetal brain and in patients with neurodegenerative diseases. The protein encoded by this gene is actually much larger than originally thought, and it also contains a C-terminal bromodomain characteristic of proteins that regulate transcription during proliferation. The encoded protein is highly similar to the largest subunit of the Drosophila NURF (nucleosome remodeling factor) complex. In Drosophila, the NURF complex, which catalyzes nucleosome sliding on DNA and interacts with sequence-specific transcription factors, is necessary for the chromatin remodeling required for transcription. Two alternative transcripts encoding different isoforms have been described completely. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with embryonic growth arrest around early gastrulation and a greatly reduced ectoplacental cone. [provided by MGI curators]

Allele List at MGI

All alleles(58) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(56)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	A	G	4: 41,505,071	S214P	possibly damaging	Het
3632451O06Rik	T	C	14: 49,773,236	D338G	probably damaging	Het
Adamts14	T	C	10: 61,202,840	T964A	possibly damaging	Het
Adamts7	G	A	9: 90,193,557	W1156*	probably null	Het
Adcy9	T	C	16: 4,288,128	I1041V	possibly damaging	Het
Art4	C	A	6: 136,854,351		probably null	Het
Bcl9	A	G	3: 97,209,018	S787P	probably benign	Het
Cdc45	T	C	16: 18,808,847	N76S	probably damaging	Het
Cdon	A	G	9: 35,478,654	D868G	probably damaging	Het
Cldn10	T	G	14: 118,855,027	V13G	probably benign	Het
Cnot6	G	T	11: 49,685,114	Q178K	probably benign	Het
Crot	T	C	5: 8,973,629	I420V	probably benign	Het
Csgalnact1	T	A	8: 68,401,453	H232L	possibly damaging	Het
Cuzd1	T	C	7: 131,308,897	I556M	possibly damaging	Het
Cyp2c54	G	A	19: 40,038,413	R433W	probably damaging	Het
Cyp2j11	A	G	4: 96,319,302	F259L	probably benign	Het
Dhx9	C	T	1: 153,473,176	G264R	probably damaging	Het
Dnah5	G	A	15: 28,299,099	V1536M	probably benign	Het
Erlin1	T	A	19: 44,069,602		probably benign	Het
Foxb2	C	A	19: 16,872,983	V220L	possibly damaging	Het
Gigyf2	A	T	1: 87,410,709	T388S	probably benign	Het
Gimap5	T	C	6: 48,753,134	C213R	probably benign	Het
Gkap1	T	G	13: 58,238,692	K57N	probably damaging	Het
Gm10696	T	C	3: 94,176,190	M105V	probably benign	Het
Gm14139	A	G	2: 150,192,780	I340M	probably benign	Het
Gm15922	T	C	7: 3,737,433	Q263R	probably benign	Het
H60b	T	G	10: 22,283,522		probably benign	Het
Hectd4	C	T	5: 121,304,426	R670*	probably null	Het
Hoxc9	A	G	15: 102,983,909	N185D	probably damaging	Het
Igkv1-117	A	G	6: 68,121,782	E105G	possibly damaging	Het
Klk10	T	A	7: 43,782,815	Y57*	probably null	Het
Lrrc63	A	T	14: 75,125,872	I273K	possibly damaging	Het
M6pr	T	C	6: 122,315,066	I119T	probably damaging	Het
Mael	T	C	1: 166,235,558		probably null	Het
Magi1	A	G	6: 93,704,349	S574P	possibly damaging	Het
Man2c1	A	G	9: 57,136,777	D291G	probably benign	Het
Mapk1ip1l	A	T	14: 47,310,463		probably benign	Het
Mrc2	A	G	11: 105,347,306	T1135A	possibly damaging	Het
Mrpl39	A	G	16: 84,730,848	V164A	probably benign	Het
Mynn	C	A	3: 30,607,141	P124H	probably damaging	Het
Olfr267	A	G	4: 58,785,203	I173T	probably damaging	Het
Olfr300-ps1	A	T	7: 86,443,854	N291I	probably damaging	Het
Olfr323	T	G	11: 58,625,974	Q23P	probably damaging	Het
Olfr330	A	G	11: 58,529,503	F161S	possibly damaging	Het
Olfr420	A	G	1: 174,159,048	I92V	probably damaging	Het
Pcif1	A	G	2: 164,884,383	N68S	probably damaging	Het
Pcm1	T	A	8: 41,275,939	N649K	probably damaging	Het
Plxna2	T	A	1: 194,793,958	I1162N	probably damaging	Het
Pnp2	T	A	14: 50,964,385	L276Q	probably damaging	Het
Sirpb1c	T	A	3: 15,848,362	I18F	possibly damaging	Het
Slc2a12	A	T	10: 22,664,779	M178L	probably damaging	Het
Slc35c1	G	T	2: 92,454,707	F187L	probably benign	Het
Smg1	T	C	7: 118,171,759		probably benign	Het
Stn1	T	C	19: 47,501,672	H342R	probably benign	Het
Sult1c1	A	T	17: 53,969,681	H117Q	probably damaging	Het
Thap1	G	A	8: 26,160,897	R42K	probably damaging	Het
Tpp2	A	T	1: 43,977,205		probably null	Het
Trib2	G	T	12: 15,815,346	P76Q	probably damaging	Het
Ttc24	G	T	3: 88,073,062	Q111K	probably damaging	Het
Ubr4	T	C	4: 139,416,647	S1401P	probably damaging	Het
Uggt1	A	C	1: 36,176,643		probably null	Het
Ugt2b1	A	G	5: 86,926,467	L11S	probably damaging	Het
Uso1	T	G	5: 92,195,363	S769A	probably benign	Het
Vmn2r117	T	C	17: 23,479,468	T44A	probably benign	Het
Vmn2r28	T	A	7: 5,486,348	L497F	probably benign	Het
Vsig10l	G	A	7: 43,464,902	S318N	probably benign	Het
Wbp4	A	G	14: 79,476,823	L83P	probably damaging	Het
Wnk1	G	A	6: 119,950,083	R1510W	probably damaging	Het
Zc3hav1l	C	T	6: 38,295,241	V198M	probably damaging	Het

Other mutations in Bptf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Bptf	APN	11	107055279	missense	possibly damaging	0.88
IGL00664:Bptf	APN	11	107077665	missense	possibly damaging	0.78
IGL00705:Bptf	APN	11	107095708	splice site	probably benign
IGL00796:Bptf	APN	11	107054550	missense	probably damaging	1.00
IGL00834:Bptf	APN	11	107073928	missense	possibly damaging	0.59
IGL01155:Bptf	APN	11	107080727	missense	probably damaging	1.00
IGL01314:Bptf	APN	11	107054853	missense	probably damaging	1.00
IGL01371:Bptf	APN	11	107055907	missense	probably benign	0.00
IGL01567:Bptf	APN	11	107058774	missense	probably damaging	1.00
IGL01794:Bptf	APN	11	107053221	critical splice donor site	probably null
IGL02108:Bptf	APN	11	107074988	missense	probably benign	0.45
IGL02367:Bptf	APN	11	107073352	missense	probably benign
IGL02437:Bptf	APN	11	107074695	missense	probably benign	0.00
IGL02589:Bptf	APN	11	107111531	missense	possibly damaging	0.92
IGL02897:Bptf	APN	11	107047121	missense	probably damaging	1.00
IGL02935:Bptf	APN	11	107080799	missense	probably damaging	1.00
IGL02954:Bptf	APN	11	107054749	missense	possibly damaging	0.89
IGL02982:Bptf	APN	11	107076674	missense	probably damaging	1.00
IGL03109:Bptf	APN	11	107061701	missense	possibly damaging	0.53
IGL03265:Bptf	APN	11	107054628	missense	probably benign	0.00
IGL03403:Bptf	APN	11	107099733	missense	possibly damaging	0.51
Anodyne	UTSW	11	107043631	critical splice donor site	probably null
Arroyo	UTSW	11	107042690	missense	probably benign	0.32
mojado	UTSW	11	107044640	missense	probably benign	0.03
IGL03097:Bptf	UTSW	11	107077680	missense	probably damaging	1.00
PIT4486001:Bptf	UTSW	11	107054788	missense	probably damaging	0.98
R0066:Bptf	UTSW	11	107062136	missense	possibly damaging	0.90
R0157:Bptf	UTSW	11	107074658	missense	possibly damaging	0.89
R0320:Bptf	UTSW	11	107072819	missense	probably damaging	1.00
R0328:Bptf	UTSW	11	107047127	missense	probably damaging	1.00
R0402:Bptf	UTSW	11	107074114	missense	probably damaging	1.00
R0482:Bptf	UTSW	11	107081262	missense	probably benign	0.13
R0574:Bptf	UTSW	11	107076527	missense	probably damaging	1.00
R0598:Bptf	UTSW	11	107072965	missense	probably damaging	0.99
R0599:Bptf	UTSW	11	107068382	missense	probably damaging	1.00
R0601:Bptf	UTSW	11	107061692	missense	probably benign	0.04
R0744:Bptf	UTSW	11	107110812	critical splice donor site	probably null
R0836:Bptf	UTSW	11	107110812	critical splice donor site	probably null
R0885:Bptf	UTSW	11	107043791	missense	probably damaging	1.00
R1070:Bptf	UTSW	11	107055055	missense	possibly damaging	0.92
R1252:Bptf	UTSW	11	107073251	missense	probably benign	0.00
R1370:Bptf	UTSW	11	107047094	missense	probably damaging	0.99
R1428:Bptf	UTSW	11	107073047	missense	probably damaging	0.99
R1467:Bptf	UTSW	11	107055055	missense	possibly damaging	0.92
R1467:Bptf	UTSW	11	107055055	missense	possibly damaging	0.92
R1742:Bptf	UTSW	11	107110951	missense	probably damaging	1.00
R1816:Bptf	UTSW	11	107060579	missense	probably damaging	1.00
R1858:Bptf	UTSW	11	107073301	missense	probably benign	0.00
R1989:Bptf	UTSW	11	107074826	missense	probably damaging	1.00
R2253:Bptf	UTSW	11	107111322	missense	probably damaging	1.00
R2392:Bptf	UTSW	11	107072747	missense	probably damaging	1.00
R2431:Bptf	UTSW	11	107047240	missense	possibly damaging	0.48
R3022:Bptf	UTSW	11	107111637	critical splice acceptor site	probably null
R3161:Bptf	UTSW	11	107074476	missense	probably damaging	1.00
R3686:Bptf	UTSW	11	107074198	missense	probably benign	0.25
R3687:Bptf	UTSW	11	107074198	missense	probably benign	0.25
R3688:Bptf	UTSW	11	107074198	missense	probably benign	0.25
R3787:Bptf	UTSW	11	107073827	missense	probably damaging	1.00
R3834:Bptf	UTSW	11	107073857	missense	probably benign	0.05
R3885:Bptf	UTSW	11	107074513	missense	probably damaging	0.97
R4090:Bptf	UTSW	11	107081523	missense	probably damaging	0.99
R4398:Bptf	UTSW	11	107110844	missense	probably damaging	1.00
R4437:Bptf	UTSW	11	107074474	missense	possibly damaging	0.59
R4514:Bptf	UTSW	11	107077692	missense	probably damaging	1.00
R4565:Bptf	UTSW	11	107073010	missense	probably damaging	1.00
R4715:Bptf	UTSW	11	107047181	missense	probably damaging	1.00
R4748:Bptf	UTSW	11	107095880	missense	probably damaging	0.96
R4764:Bptf	UTSW	11	107043694	missense	probably damaging	1.00
R4885:Bptf	UTSW	11	107074648	missense	probably benign	0.39
R4901:Bptf	UTSW	11	107110860	nonsense	probably null
R4995:Bptf	UTSW	11	107054565	missense	probably damaging	0.98
R5057:Bptf	UTSW	11	107082528	missense	probably damaging	0.98
R5120:Bptf	UTSW	11	107073385	missense	probably damaging	0.99
R5320:Bptf	UTSW	11	107081367	nonsense	probably null
R5329:Bptf	UTSW	11	107073295	missense	probably benign	0.06
R5418:Bptf	UTSW	11	107111294	missense	probably damaging	1.00
R5461:Bptf	UTSW	11	107061764	missense	probably damaging	1.00
R5664:Bptf	UTSW	11	107073699	missense	probably benign	0.01
R5718:Bptf	UTSW	11	107111434	missense	probably damaging	1.00
R5774:Bptf	UTSW	11	107111137	missense	probably damaging	1.00
R5851:Bptf	UTSW	11	107110862	missense	probably damaging	1.00
R5930:Bptf	UTSW	11	107073196	missense	probably damaging	1.00
R5949:Bptf	UTSW	11	107111089	missense	probably damaging	0.99
R5975:Bptf	UTSW	11	107035864	utr 3 prime	probably benign
R6027:Bptf	UTSW	11	107074945	missense	probably damaging	1.00
R6128:Bptf	UTSW	11	107074690	missense	possibly damaging	0.87
R6337:Bptf	UTSW	11	107058779	missense	possibly damaging	0.89
R6407:Bptf	UTSW	11	107111126	missense	probably damaging	1.00
R6470:Bptf	UTSW	11	107072767	missense	probably damaging	1.00
R6487:Bptf	UTSW	11	107077726	missense	probably damaging	0.99
R6501:Bptf	UTSW	11	107077683	missense	probably null	1.00
R6755:Bptf	UTSW	11	107047256	missense	probably benign	0.27
R6861:Bptf	UTSW	11	107062565	missense	probably damaging	1.00
R6866:Bptf	UTSW	11	107073580	missense	probably damaging	1.00
R6879:Bptf	UTSW	11	107042690	missense	probably benign	0.32
R6927:Bptf	UTSW	11	107054595	missense	probably damaging	1.00
R6944:Bptf	UTSW	11	107080823	missense	probably damaging	1.00
R7082:Bptf	UTSW	11	107086747	missense	probably benign	0.00
R7136:Bptf	UTSW	11	107099715	missense	probably damaging	1.00
R7162:Bptf	UTSW	11	107043631	critical splice donor site	probably null
R7171:Bptf	UTSW	11	107131407	missense	unknown
R7193:Bptf	UTSW	11	107054809	nonsense	probably null
R7210:Bptf	UTSW	11	107054464	nonsense	probably null
R7221:Bptf	UTSW	11	107054832	missense	probably damaging	1.00
R7316:Bptf	UTSW	11	107073109	missense	probably damaging	1.00
R7316:Bptf	UTSW	11	107110914	nonsense	probably null
R7422:Bptf	UTSW	11	107060558	missense	probably damaging	1.00
R7454:Bptf	UTSW	11	107044640	missense	probably benign	0.03
R7657:Bptf	UTSW	11	107074729	missense	probably damaging	1.00
R7718:Bptf	UTSW	11	107081456	missense	possibly damaging	0.65
R7827:Bptf	UTSW	11	107047187	missense	probably benign	0.01
R7844:Bptf	UTSW	11	107074061	missense	probably damaging	0.97
R7992:Bptf	UTSW	11	107110883	missense	probably benign	0.00
R8001:Bptf	UTSW	11	107047340	nonsense	probably null
R8037:Bptf	UTSW	11	107055950	missense	probably damaging	1.00
R8122:Bptf	UTSW	11	107036591	critical splice acceptor site	probably null
R8235:Bptf	UTSW	11	107076632	missense	probably benign	0.04
R8308:Bptf	UTSW	11	107052989	missense	probably damaging	0.99
R8409:Bptf	UTSW	11	107062669	missense	probably damaging	1.00
R8464:Bptf	UTSW	11	107131342	missense	probably benign	0.01
R8477:Bptf	UTSW	11	107052853	missense	probably damaging	0.98
R8482:Bptf	UTSW	11	107043698	missense	probably benign	0.19
R8515:Bptf	UTSW	11	107055238	missense	possibly damaging	0.85
R8708:Bptf	UTSW	11	107073313	missense	probably damaging	0.99
R8708:Bptf	UTSW	11	107073314	missense	probably damaging	1.00
R8722:Bptf	UTSW	11	107131469	missense	unknown
R8732:Bptf	UTSW	11	107040380	missense	probably damaging	1.00
R8783:Bptf	UTSW	11	107131531	missense	unknown
R8828:Bptf	UTSW	11	107055010	missense	probably damaging	0.98
R9004:Bptf	UTSW	11	107054887	missense	probably damaging	1.00
R9010:Bptf	UTSW	11	107073750	missense	probably damaging	1.00
R9035:Bptf	UTSW	11	107073016	missense	probably damaging	1.00
R9083:Bptf	UTSW	11	107068350	missense	probably damaging	1.00
R9211:Bptf	UTSW	11	107055298	missense	probably damaging	1.00
R9345:Bptf	UTSW	11	107080762	missense	possibly damaging	0.77
R9393:Bptf	UTSW	11	107074308	missense	probably benign	0.00
R9451:Bptf	UTSW	11	107044585	missense	probably damaging	1.00
R9561:Bptf	UTSW	11	107074128	nonsense	probably null
R9632:Bptf	UTSW	11	107061719	missense	probably damaging	1.00
R9648:Bptf	UTSW	11	107052894	missense	probably damaging	0.99
R9650:Bptf	UTSW	11	107044586	missense	probably benign	0.15
R9658:Bptf	UTSW	11	107111344	missense	probably damaging	1.00
R9775:Bptf	UTSW	11	107043676	missense	probably benign	0.04
R9776:Bptf	UTSW	11	107078570	missense	probably damaging	1.00
Z1088:Bptf	UTSW	11	107074582	missense	probably benign	0.00
Z1176:Bptf	UTSW	11	107058684	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCCAAATCAGTACTTCATCACAG -3'
(R):5'- ACATTCTGTGTAGCCCACTCTG -3'

Sequencing Primer
(F):5'- GGCTATAGAGAAACCCTGTCTCG -3'
(R):5'- GTGTAGCCCACTCTGCAACC -3'

Posted On

2021-01-18