Incidental Mutation 'R8519:Lrrc63'
ID 658555
Institutional Source Beutler Lab
Gene Symbol Lrrc63
Ensembl Gene ENSMUSG00000021997
Gene Name leucine rich repeat containing 63
Synonyms 4921509B22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock # R8519 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 75084303-75130881 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 75125872 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 273 (I273K)
Ref Sequence ENSEMBL: ENSMUSP00000022574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022574]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000022574
AA Change: I273K

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022574
Gene: ENSMUSG00000021997
AA Change: I273K

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 276 310 N/A INTRINSIC
LRR 412 434 2.82e0 SMART
LRR 435 458 1.45e1 SMART
LRR 481 504 1.53e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A G 4: 41,505,071 S214P possibly damaging Het
3632451O06Rik T C 14: 49,773,236 D338G probably damaging Het
Adamts14 T C 10: 61,202,840 T964A possibly damaging Het
Adamts7 G A 9: 90,193,557 W1156* probably null Het
Adcy9 T C 16: 4,288,128 I1041V possibly damaging Het
Art4 C A 6: 136,854,351 probably null Het
Bcl9 A G 3: 97,209,018 S787P probably benign Het
Bptf T C 11: 107,061,764 T2088A probably damaging Het
Cdc45 T C 16: 18,808,847 N76S probably damaging Het
Cdon A G 9: 35,478,654 D868G probably damaging Het
Cldn10 T G 14: 118,855,027 V13G probably benign Het
Cnot6 G T 11: 49,685,114 Q178K probably benign Het
Crot T C 5: 8,973,629 I420V probably benign Het
Csgalnact1 T A 8: 68,401,453 H232L possibly damaging Het
Cuzd1 T C 7: 131,308,897 I556M possibly damaging Het
Cyp2c54 G A 19: 40,038,413 R433W probably damaging Het
Cyp2j11 A G 4: 96,319,302 F259L probably benign Het
Dhx9 C T 1: 153,473,176 G264R probably damaging Het
Dnah5 G A 15: 28,299,099 V1536M probably benign Het
Erlin1 T A 19: 44,069,602 probably benign Het
Foxb2 C A 19: 16,872,983 V220L possibly damaging Het
Gigyf2 A T 1: 87,410,709 T388S probably benign Het
Gimap5 T C 6: 48,753,134 C213R probably benign Het
Gkap1 T G 13: 58,238,692 K57N probably damaging Het
Gm10696 T C 3: 94,176,190 M105V probably benign Het
Gm14139 A G 2: 150,192,780 I340M probably benign Het
Gm15922 T C 7: 3,737,433 Q263R probably benign Het
H60b T G 10: 22,283,522 probably benign Het
Hectd4 C T 5: 121,304,426 R670* probably null Het
Hoxc9 A G 15: 102,983,909 N185D probably damaging Het
Igkv1-117 A G 6: 68,121,782 E105G possibly damaging Het
Klk10 T A 7: 43,782,815 Y57* probably null Het
M6pr T C 6: 122,315,066 I119T probably damaging Het
Mael T C 1: 166,235,558 probably null Het
Magi1 A G 6: 93,704,349 S574P possibly damaging Het
Man2c1 A G 9: 57,136,777 D291G probably benign Het
Mapk1ip1l A T 14: 47,310,463 probably benign Het
Mrc2 A G 11: 105,347,306 T1135A possibly damaging Het
Mrpl39 A G 16: 84,730,848 V164A probably benign Het
Mynn C A 3: 30,607,141 P124H probably damaging Het
Olfr267 A G 4: 58,785,203 I173T probably damaging Het
Olfr300-ps1 A T 7: 86,443,854 N291I probably damaging Het
Olfr323 T G 11: 58,625,974 Q23P probably damaging Het
Olfr330 A G 11: 58,529,503 F161S possibly damaging Het
Olfr420 A G 1: 174,159,048 I92V probably damaging Het
Pcif1 A G 2: 164,884,383 N68S probably damaging Het
Pcm1 T A 8: 41,275,939 N649K probably damaging Het
Plxna2 T A 1: 194,793,958 I1162N probably damaging Het
Pnp2 T A 14: 50,964,385 L276Q probably damaging Het
Sirpb1c T A 3: 15,848,362 I18F possibly damaging Het
Slc2a12 A T 10: 22,664,779 M178L probably damaging Het
Slc35c1 G T 2: 92,454,707 F187L probably benign Het
Smg1 T C 7: 118,171,759 probably benign Het
Stn1 T C 19: 47,501,672 H342R probably benign Het
Sult1c1 A T 17: 53,969,681 H117Q probably damaging Het
Thap1 G A 8: 26,160,897 R42K probably damaging Het
Tpp2 A T 1: 43,977,205 probably null Het
Trib2 G T 12: 15,815,346 P76Q probably damaging Het
Ttc24 G T 3: 88,073,062 Q111K probably damaging Het
Ubr4 T C 4: 139,416,647 S1401P probably damaging Het
Uggt1 A C 1: 36,176,643 probably null Het
Ugt2b1 A G 5: 86,926,467 L11S probably damaging Het
Uso1 T G 5: 92,195,363 S769A probably benign Het
Vmn2r117 T C 17: 23,479,468 T44A probably benign Het
Vmn2r28 T A 7: 5,486,348 L497F probably benign Het
Vsig10l G A 7: 43,464,902 S318N probably benign Het
Wbp4 A G 14: 79,476,823 L83P probably damaging Het
Wnk1 G A 6: 119,950,083 R1510W probably damaging Het
Zc3hav1l C T 6: 38,295,241 V198M probably damaging Het
Other mutations in Lrrc63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:Lrrc63 APN 14 75084982 missense possibly damaging 0.73
IGL02222:Lrrc63 APN 14 75086140 missense probably damaging 0.99
IGL02385:Lrrc63 APN 14 75086200 missense probably benign
FR4548:Lrrc63 UTSW 14 75125182 small deletion probably benign
FR4589:Lrrc63 UTSW 14 75125182 small deletion probably benign
R0398:Lrrc63 UTSW 14 75126470 missense probably benign 0.06
R0637:Lrrc63 UTSW 14 75098220 splice site probably benign
R0669:Lrrc63 UTSW 14 75126110 missense probably benign 0.27
R1465:Lrrc63 UTSW 14 75107389 missense possibly damaging 0.92
R1465:Lrrc63 UTSW 14 75107389 missense possibly damaging 0.92
R1478:Lrrc63 UTSW 14 75125984 missense probably benign
R1591:Lrrc63 UTSW 14 75125892 missense possibly damaging 0.92
R1753:Lrrc63 UTSW 14 75086344 splice site probably null
R3713:Lrrc63 UTSW 14 75107336 missense probably benign 0.12
R4013:Lrrc63 UTSW 14 75098291 missense probably damaging 0.98
R4793:Lrrc63 UTSW 14 75126161 missense possibly damaging 0.93
R4888:Lrrc63 UTSW 14 75125966 missense probably benign
R4937:Lrrc63 UTSW 14 75084949 missense probably damaging 0.99
R5197:Lrrc63 UTSW 14 75084882 missense possibly damaging 0.68
R5747:Lrrc63 UTSW 14 75126464 missense probably benign
R5861:Lrrc63 UTSW 14 75107366 missense possibly damaging 0.83
R5905:Lrrc63 UTSW 14 75086174 missense possibly damaging 0.92
R6028:Lrrc63 UTSW 14 75086174 missense possibly damaging 0.92
R6661:Lrrc63 UTSW 14 75125193 missense unknown
R6982:Lrrc63 UTSW 14 75084771 missense probably benign 0.33
R7062:Lrrc63 UTSW 14 75086297 missense probably benign 0.00
R7439:Lrrc63 UTSW 14 75126257 missense possibly damaging 0.84
R7440:Lrrc63 UTSW 14 75121013 missense possibly damaging 0.91
R7441:Lrrc63 UTSW 14 75126257 missense possibly damaging 0.84
R7474:Lrrc63 UTSW 14 75126203 missense possibly damaging 0.83
R7604:Lrrc63 UTSW 14 75084969 missense possibly damaging 0.68
R7703:Lrrc63 UTSW 14 75123007 missense possibly damaging 0.91
R7819:Lrrc63 UTSW 14 75125221 small insertion probably benign
R8970:Lrrc63 UTSW 14 75125191 missense unknown
R9025:Lrrc63 UTSW 14 75084844 missense probably benign
R9547:Lrrc63 UTSW 14 75107388 missense probably damaging 0.99
R9589:Lrrc63 UTSW 14 75084939 missense possibly damaging 0.68
R9780:Lrrc63 UTSW 14 75123060 missense probably damaging 0.99
Z1088:Lrrc63 UTSW 14 75125990 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGGCTGAGGTACGAAGTGTTAATC -3'
(R):5'- AGCCCTGTACCTAGCACTTC -3'

Sequencing Primer
(F):5'- CTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- TCATCTGTAATACCTGAACCGCAGTG -3'
Posted On 2021-01-18