Mutagenetix > Incidental Mutation

Incidental Mutation 'R8519:Vmn2r117'

658563

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r117

Ensembl Gene

ENSMUSG00000091407

Gene Name

vomeronasal 2, receptor 117

Synonyms

EG619788

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.075) question?

Stock #

R8519 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23459675-23479597 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23479468 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 44 (T44A)

Ref Sequence

ENSEMBL: ENSMUSP00000126885 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171996]

AlphaFold

K7N6V1

Predicted Effect

probably benign
Transcript: ENSMUST00000171996
AA Change: T44A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000126885
Gene: ENSMUSG00000091407
AA Change: T44A

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	471	2.6e-28	PFAM
Pfam:NCD3G	512	565	5e-20	PFAM
Pfam:7tm_3	595	833	8.2e-54	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (67/67)

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	A	G	4: 41,505,071	S214P	possibly damaging	Het
3632451O06Rik	T	C	14: 49,773,236	D338G	probably damaging	Het
Adamts14	T	C	10: 61,202,840	T964A	possibly damaging	Het
Adamts7	G	A	9: 90,193,557	W1156*	probably null	Het
Adcy9	T	C	16: 4,288,128	I1041V	possibly damaging	Het
Art4	C	A	6: 136,854,351		probably null	Het
Bcl9	A	G	3: 97,209,018	S787P	probably benign	Het
Bptf	T	C	11: 107,061,764	T2088A	probably damaging	Het
Cdc45	T	C	16: 18,808,847	N76S	probably damaging	Het
Cdon	A	G	9: 35,478,654	D868G	probably damaging	Het
Cldn10	T	G	14: 118,855,027	V13G	probably benign	Het
Cnot6	G	T	11: 49,685,114	Q178K	probably benign	Het
Crot	T	C	5: 8,973,629	I420V	probably benign	Het
Csgalnact1	T	A	8: 68,401,453	H232L	possibly damaging	Het
Cuzd1	T	C	7: 131,308,897	I556M	possibly damaging	Het
Cyp2c54	G	A	19: 40,038,413	R433W	probably damaging	Het
Cyp2j11	A	G	4: 96,319,302	F259L	probably benign	Het
Dhx9	C	T	1: 153,473,176	G264R	probably damaging	Het
Dnah5	G	A	15: 28,299,099	V1536M	probably benign	Het
Erlin1	T	A	19: 44,069,602		probably benign	Het
Foxb2	C	A	19: 16,872,983	V220L	possibly damaging	Het
Gigyf2	A	T	1: 87,410,709	T388S	probably benign	Het
Gimap5	T	C	6: 48,753,134	C213R	probably benign	Het
Gkap1	T	G	13: 58,238,692	K57N	probably damaging	Het
Gm10696	T	C	3: 94,176,190	M105V	probably benign	Het
Gm14139	A	G	2: 150,192,780	I340M	probably benign	Het
Gm15922	T	C	7: 3,737,433	Q263R	probably benign	Het
H60b	T	G	10: 22,283,522		probably benign	Het
Hectd4	C	T	5: 121,304,426	R670*	probably null	Het
Hoxc9	A	G	15: 102,983,909	N185D	probably damaging	Het
Igkv1-117	A	G	6: 68,121,782	E105G	possibly damaging	Het
Klk10	T	A	7: 43,782,815	Y57*	probably null	Het
Lrrc63	A	T	14: 75,125,872	I273K	possibly damaging	Het
M6pr	T	C	6: 122,315,066	I119T	probably damaging	Het
Mael	T	C	1: 166,235,558		probably null	Het
Magi1	A	G	6: 93,704,349	S574P	possibly damaging	Het
Man2c1	A	G	9: 57,136,777	D291G	probably benign	Het
Mapk1ip1l	A	T	14: 47,310,463		probably benign	Het
Mrc2	A	G	11: 105,347,306	T1135A	possibly damaging	Het
Mrpl39	A	G	16: 84,730,848	V164A	probably benign	Het
Mynn	C	A	3: 30,607,141	P124H	probably damaging	Het
Olfr267	A	G	4: 58,785,203	I173T	probably damaging	Het
Olfr300-ps1	A	T	7: 86,443,854	N291I	probably damaging	Het
Olfr323	T	G	11: 58,625,974	Q23P	probably damaging	Het
Olfr330	A	G	11: 58,529,503	F161S	possibly damaging	Het
Olfr420	A	G	1: 174,159,048	I92V	probably damaging	Het
Pcif1	A	G	2: 164,884,383	N68S	probably damaging	Het
Pcm1	T	A	8: 41,275,939	N649K	probably damaging	Het
Plxna2	T	A	1: 194,793,958	I1162N	probably damaging	Het
Pnp2	T	A	14: 50,964,385	L276Q	probably damaging	Het
Sirpb1c	T	A	3: 15,848,362	I18F	possibly damaging	Het
Slc2a12	A	T	10: 22,664,779	M178L	probably damaging	Het
Slc35c1	G	T	2: 92,454,707	F187L	probably benign	Het
Smg1	T	C	7: 118,171,759		probably benign	Het
Stn1	T	C	19: 47,501,672	H342R	probably benign	Het
Sult1c1	A	T	17: 53,969,681	H117Q	probably damaging	Het
Thap1	G	A	8: 26,160,897	R42K	probably damaging	Het
Tpp2	A	T	1: 43,977,205		probably null	Het
Trib2	G	T	12: 15,815,346	P76Q	probably damaging	Het
Ttc24	G	T	3: 88,073,062	Q111K	probably damaging	Het
Ubr4	T	C	4: 139,416,647	S1401P	probably damaging	Het
Uggt1	A	C	1: 36,176,643		probably null	Het
Ugt2b1	A	G	5: 86,926,467	L11S	probably damaging	Het
Uso1	T	G	5: 92,195,363	S769A	probably benign	Het
Vmn2r28	T	A	7: 5,486,348	L497F	probably benign	Het
Vsig10l	G	A	7: 43,464,902	S318N	probably benign	Het
Wbp4	A	G	14: 79,476,823	L83P	probably damaging	Het
Wnk1	G	A	6: 119,950,083	R1510W	probably damaging	Het
Zc3hav1l	C	T	6: 38,295,241	V198M	probably damaging	Het

Other mutations in Vmn2r117

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Vmn2r117	APN	17	23477840	missense	probably damaging	1.00
IGL00990:Vmn2r117	APN	17	23475429	missense	probably damaging	1.00
IGL00990:Vmn2r117	APN	17	23479546	missense	probably benign
IGL01078:Vmn2r117	APN	17	23477804	missense	probably damaging	1.00
IGL01139:Vmn2r117	APN	17	23477804	missense	probably damaging	1.00
IGL01374:Vmn2r117	APN	17	23478382	missense	possibly damaging	0.46
IGL01779:Vmn2r117	APN	17	23477241	missense	probably benign	0.00
IGL02283:Vmn2r117	APN	17	23475382	missense	probably damaging	0.99
IGL02527:Vmn2r117	APN	17	23477225	missense	possibly damaging	0.65
IGL02612:Vmn2r117	APN	17	23459784	missense	possibly damaging	0.91
IGL02887:Vmn2r117	APN	17	23475578	splice site	probably benign
IGL03167:Vmn2r117	APN	17	23477707	missense	probably damaging	1.00
R0315:Vmn2r117	UTSW	17	23460165	missense	probably benign	0.11
R0610:Vmn2r117	UTSW	17	23475514	missense	probably benign	0.00
R0747:Vmn2r117	UTSW	17	23475503	nonsense	probably null
R1411:Vmn2r117	UTSW	17	23460553	missense	probably damaging	1.00
R1471:Vmn2r117	UTSW	17	23478473	missense	probably benign	0.00
R1853:Vmn2r117	UTSW	17	23477455	missense	probably damaging	0.99
R1925:Vmn2r117	UTSW	17	23478389	missense	probably benign	0.00
R1940:Vmn2r117	UTSW	17	23477480	missense	probably damaging	1.00
R2005:Vmn2r117	UTSW	17	23477644	missense	probably damaging	1.00
R2082:Vmn2r117	UTSW	17	23460256	missense	possibly damaging	0.55
R2698:Vmn2r117	UTSW	17	23459911	missense	probably damaging	0.98
R2972:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R2973:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R2974:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R3160:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3161:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3162:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3847:Vmn2r117	UTSW	17	23460415	missense	probably damaging	0.97
R3848:Vmn2r117	UTSW	17	23460415	missense	probably damaging	0.97
R4082:Vmn2r117	UTSW	17	23460106	missense	probably benign	0.00
R4320:Vmn2r117	UTSW	17	23479513	frame shift	probably null
R4560:Vmn2r117	UTSW	17	23459877	missense	probably damaging	1.00
R4658:Vmn2r117	UTSW	17	23478416	missense	probably benign	0.01
R4881:Vmn2r117	UTSW	17	23477885	missense	probably damaging	1.00
R4908:Vmn2r117	UTSW	17	23459838	missense	probably damaging	1.00
R4910:Vmn2r117	UTSW	17	23479513	frame shift	probably null
R5078:Vmn2r117	UTSW	17	23460148	missense	probably damaging	1.00
R5327:Vmn2r117	UTSW	17	23477874	nonsense	probably null
R5774:Vmn2r117	UTSW	17	23477202	missense	probably damaging	0.98
R6014:Vmn2r117	UTSW	17	23479561	missense	probably damaging	0.97
R6390:Vmn2r117	UTSW	17	23460114	missense	possibly damaging	0.95
R6520:Vmn2r117	UTSW	17	23460219	missense	probably damaging	0.99
R6674:Vmn2r117	UTSW	17	23460049	nonsense	probably null
R6736:Vmn2r117	UTSW	17	23478308	missense	probably damaging	0.99
R6909:Vmn2r117	UTSW	17	23479505	missense	possibly damaging	0.67
R6913:Vmn2r117	UTSW	17	23479563	missense	probably damaging	0.99
R7220:Vmn2r117	UTSW	17	23477203	missense	probably damaging	1.00
R7260:Vmn2r117	UTSW	17	23475385	missense	probably benign	0.06
R7440:Vmn2r117	UTSW	17	23475565	missense	probably benign	0.26
R7443:Vmn2r117	UTSW	17	23460133	missense	probably benign	0.25
R7443:Vmn2r117	UTSW	17	23460345	missense	probably damaging	1.00
R7449:Vmn2r117	UTSW	17	23459895	missense	probably damaging	1.00
R7644:Vmn2r117	UTSW	17	23477291	missense	probably damaging	0.98
R7914:Vmn2r117	UTSW	17	23460126	missense	possibly damaging	0.95
R8001:Vmn2r117	UTSW	17	23479407	missense	possibly damaging	0.89
R8029:Vmn2r117	UTSW	17	23477770	missense	probably benign	0.00
R8340:Vmn2r117	UTSW	17	23460537	missense	probably benign	0.01
R8723:Vmn2r117	UTSW	17	23477369	missense	probably damaging	1.00
R8914:Vmn2r117	UTSW	17	23460169	missense	probably benign	0.02
R9010:Vmn2r117	UTSW	17	23460471	missense	probably benign	0.10
R9129:Vmn2r117	UTSW	17	23459944	nonsense	probably null
R9244:Vmn2r117	UTSW	17	23477615	missense	probably damaging	0.98
R9464:Vmn2r117	UTSW	17	23477604	missense	probably benign	0.23
R9620:Vmn2r117	UTSW	17	23478476	missense	probably damaging	0.97
V5622:Vmn2r117	UTSW	17	23477840	missense	probably damaging	1.00
V5622:Vmn2r117	UTSW	17	23479505	missense	possibly damaging	0.67
Z1176:Vmn2r117	UTSW	17	23459766	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCATTCCTAAGTGTGAGGCTG -3'
(R):5'- CACAATCAATTCTGCCCAGG -3'

Sequencing Primer
(F):5'- TCATCCTCAGTAGTCTTGGG -3'
(R):5'- ATTCTGCCCAGGCTCAGAAGAG -3'

Posted On

2021-01-18