Incidental Mutation 'R8520:Pax8'
ID 658577
Institutional Source Beutler Lab
Gene Symbol Pax8
Ensembl Gene ENSMUSG00000026976
Gene Name paired box 8
Synonyms Pax-8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8520 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 24420560-24475599 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24443022 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 103 (F103I)
Ref Sequence ENSEMBL: ENSMUSP00000134343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028355] [ENSMUST00000136228] [ENSMUST00000149294] [ENSMUST00000153535] [ENSMUST00000153601]
AlphaFold Q00288
Predicted Effect possibly damaging
Transcript: ENSMUST00000028355
AA Change: F103I

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028355
Gene: ENSMUSG00000026976
AA Change: F103I

DomainStartEndE-ValueType
PAX 9 133 3.1e-93 SMART
SCOP:d1ftt__ 221 247 8e-5 SMART
low complexity region 311 328 N/A INTRINSIC
Pfam:Pax2_C 344 456 2.3e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136228
AA Change: F104I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133316
Gene: ENSMUSG00000026976
AA Change: F104I

DomainStartEndE-ValueType
PAX 9 134 9.13e-91 SMART
SCOP:d1fjla_ 221 248 8e-5 SMART
low complexity region 312 329 N/A INTRINSIC
Pfam:Pax2_C 342 404 1.2e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149294
AA Change: F103I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115194
Gene: ENSMUSG00000026976
AA Change: F103I

DomainStartEndE-ValueType
PAX 9 133 3.1e-93 SMART
SCOP:d1ftt__ 221 247 3e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000153535
AA Change: F104I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120319
Gene: ENSMUSG00000026976
AA Change: F104I

DomainStartEndE-ValueType
PAX 9 134 9.13e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000153601
AA Change: F103I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134343
Gene: ENSMUSG00000026976
AA Change: F103I

DomainStartEndE-ValueType
SCOP:d1ftt__ 23 49 1e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene encodes a member of a family of transcription factors that contain a characteristic N-terminal paired DNA-binding domain. The encoded protein is important for proper differentiation of the thyroid and the kidney. Alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for targeted mutations exhibit severe hypothyroidism due to thyroid follicular cell aplasia, male infertility, deafness, ataxia, growth retardation, tiny spleens, impaired ossification of long bones and maturation of the small intestine, fatty livers, and lethality around weaning age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,609 F136L possibly damaging Het
A430033K04Rik T A 5: 138,646,706 N284K possibly damaging Het
Abcb1a T C 5: 8,685,346 I151T possibly damaging Het
Adam28 C T 14: 68,642,083 G172D probably damaging Het
Adcy6 A G 15: 98,604,160 V191A probably benign Het
Ankrd52 T C 10: 128,389,490 L911P probably damaging Het
C5ar1 A G 7: 16,248,151 S315P probably damaging Het
Cubn A G 2: 13,308,520 probably null Het
Dlec1 T C 9: 119,112,209 S276P probably benign Het
Dnah14 T A 1: 181,653,638 I1564N probably damaging Het
Dsg2 G A 18: 20,579,451 G171R probably damaging Het
Dusp13 C A 14: 21,743,470 G208* probably null Het
Ebf3 A C 7: 137,201,124 probably null Het
Fbn2 A T 18: 58,038,198 probably null Het
Fbxo27 A G 7: 28,693,342 D16G probably benign Het
G6pc3 A G 11: 102,193,108 S187G probably benign Het
Gucy2d G A 7: 98,472,306 V995I probably null Het
Hmcn2 C A 2: 31,354,714 P728T probably damaging Het
Il1r2 T C 1: 40,105,339 L62P probably damaging Het
Ints7 T C 1: 191,582,491 S63P probably damaging Het
Mcf2l C A 8: 12,880,089 D36E probably benign Het
Mfsd13b T G 7: 120,991,363 I109S probably benign Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Mydgf C A 17: 56,183,734 probably null Het
Nanog A T 6: 122,713,516 L268F possibly damaging Het
Olfr305 A T 7: 86,364,263 C25S probably benign Het
Olfr536 T A 7: 140,504,402 D19V probably benign Het
Otud4 T A 8: 79,659,267 N256K probably damaging Het
P2rx1 A T 11: 73,008,953 D128V probably benign Het
Pappa G A 4: 65,335,764 V1552I probably benign Het
Ptk2b T A 14: 66,174,755 S396C probably damaging Het
Rnf148 A G 6: 23,654,170 Y276H probably damaging Het
Sec11c A T 18: 65,814,840 I93L probably damaging Het
Serpinb2 T A 1: 107,523,180 N217K probably benign Het
Slc2a13 T A 15: 91,572,902 T66S probably damaging Het
Slc4a3 T C 1: 75,549,862 M9T probably benign Het
Sord G A 2: 122,256,942 V176I possibly damaging Het
Thbs4 G A 13: 92,754,284 Q892* probably null Het
Thsd7b T A 1: 129,921,420 D956E probably benign Het
Tmem251 T A 12: 102,744,172 probably null Het
Topbp1 T A 9: 103,308,977 probably null Het
Tst T C 15: 78,405,253 E194G probably damaging Het
Ttk T A 9: 83,857,327 S484T possibly damaging Het
U2surp A G 9: 95,502,554 S26P possibly damaging Het
Ugt2b37 C T 5: 87,240,855 A500T probably benign Het
Utrn A T 10: 12,670,186 Y1669* probably null Het
Vmn2r23 A T 6: 123,741,656 Q656L probably damaging Het
Wdr7 A G 18: 63,987,160 N1424S probably benign Het
Xkr9 A G 1: 13,701,379 D373G probably benign Het
Zfp984 T A 4: 147,756,211 Y61F probably benign Het
Other mutations in Pax8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Pax8 APN 2 24443132 missense probably damaging 1.00
IGL01118:Pax8 APN 2 24442932 splice site probably benign
IGL01141:Pax8 APN 2 24441150 missense probably damaging 1.00
IGL01338:Pax8 APN 2 24435919 missense possibly damaging 0.93
IGL01801:Pax8 APN 2 24444564 critical splice donor site probably null
IGL02159:Pax8 APN 2 24440788 missense possibly damaging 0.56
IGL02727:Pax8 APN 2 24441630 missense probably damaging 0.98
IGL02887:Pax8 APN 2 24444615 missense probably damaging 1.00
IGL03134:Pax8 UTSW 2 24421391 unclassified probably benign
R1499:Pax8 UTSW 2 24429596 missense possibly damaging 0.92
R1756:Pax8 UTSW 2 24435821 missense probably damaging 0.98
R2051:Pax8 UTSW 2 24436508 missense probably benign
R2234:Pax8 UTSW 2 24443102 missense probably damaging 1.00
R2289:Pax8 UTSW 2 24440740 missense probably benign 0.00
R2306:Pax8 UTSW 2 24443045 missense probably damaging 1.00
R4328:Pax8 UTSW 2 24441651 missense possibly damaging 0.92
R4434:Pax8 UTSW 2 24429609 missense possibly damaging 0.93
R4592:Pax8 UTSW 2 24443189 intron probably benign
R4610:Pax8 UTSW 2 24421583 missense probably damaging 0.99
R4873:Pax8 UTSW 2 24441640 missense probably benign 0.04
R4875:Pax8 UTSW 2 24441640 missense probably benign 0.04
R5394:Pax8 UTSW 2 24442910 intron probably benign
R5924:Pax8 UTSW 2 24421622 missense probably damaging 0.97
R6796:Pax8 UTSW 2 24441086 missense probably benign 0.04
R7658:Pax8 UTSW 2 24436511 missense probably benign 0.00
R7660:Pax8 UTSW 2 24436561 missense probably benign
R7690:Pax8 UTSW 2 24441670 missense probably benign 0.37
R7775:Pax8 UTSW 2 24435901 missense possibly damaging 0.93
R7793:Pax8 UTSW 2 24429597 missense possibly damaging 0.85
R7824:Pax8 UTSW 2 24435901 missense possibly damaging 0.93
R7859:Pax8 UTSW 2 24421555 missense possibly damaging 0.93
R8225:Pax8 UTSW 2 24422971 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGAACTCCTGCCTGATTCTTC -3'
(R):5'- AGGTCCATGTTCAAAGGCCC -3'

Sequencing Primer
(F):5'- CCTGCCTGATTCTTCAAATTAAAGAG -3'
(R):5'- CCCACCTGCTTATTGGGTAATTTTGG -3'
Posted On 2021-01-18