Mutagenetix > Incidental Mutations

Incidental Mutation 'R8520:Vmn2r23'

658587

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r23

Ensembl Gene

ENSMUSG00000091620

Gene Name

vomeronasal 2, receptor 23

Synonyms

EG435916

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.074) question?

Stock #

R8520 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123702821-123742291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 123741656 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 656 (Q656L)

Ref Sequence

ENSEMBL: ENSMUSP00000126682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172391]

AlphaFold

E9PXI5

Predicted Effect

probably damaging
Transcript: ENSMUST00000172391
AA Change: Q656L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: Q656L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	79	461	1.7e-31	PFAM
Pfam:NCD3G	513	566	1.2e-23	PFAM
Pfam:7tm_3	596	834	1.5e-55	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (51/51)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	T	13: 59,690,609	F136L	possibly damaging	Het
A430033K04Rik	T	A	5: 138,646,706	N284K	possibly damaging	Het
Abcb1a	T	C	5: 8,685,346	I151T	possibly damaging	Het
Adam28	C	T	14: 68,642,083	G172D	probably damaging	Het
Adcy6	A	G	15: 98,604,160	V191A	probably benign	Het
Ankrd52	T	C	10: 128,389,490	L911P	probably damaging	Het
C5ar1	A	G	7: 16,248,151	S315P	probably damaging	Het
Cubn	A	G	2: 13,308,520		probably null	Het
Dlec1	T	C	9: 119,112,209	S276P	probably benign	Het
Dnah14	T	A	1: 181,653,638	I1564N	probably damaging	Het
Dsg2	G	A	18: 20,579,451	G171R	probably damaging	Het
Dusp13	C	A	14: 21,743,470	G208*	probably null	Het
Ebf3	A	C	7: 137,201,124		probably null	Het
Fbn2	A	T	18: 58,038,198		probably null	Het
Fbxo27	A	G	7: 28,693,342	D16G	probably benign	Het
G6pc3	A	G	11: 102,193,108	S187G	probably benign	Het
Gucy2d	G	A	7: 98,472,306	V995I	probably null	Het
Hmcn2	C	A	2: 31,354,714	P728T	probably damaging	Het
Il1r2	T	C	1: 40,105,339	L62P	probably damaging	Het
Ints7	T	C	1: 191,582,491	S63P	probably damaging	Het
Mcf2l	C	A	8: 12,880,089	D36E	probably benign	Het
Mfsd13b	T	G	7: 120,991,363	I109S	probably benign	Het
Mier2	G	A	10: 79,542,429	H385Y	possibly damaging	Het
Mydgf	C	A	17: 56,183,734		probably null	Het
Nanog	A	T	6: 122,713,516	L268F	possibly damaging	Het
Olfr305	A	T	7: 86,364,263	C25S	probably benign	Het
Olfr536	T	A	7: 140,504,402	D19V	probably benign	Het
Otud4	T	A	8: 79,659,267	N256K	probably damaging	Het
P2rx1	A	T	11: 73,008,953	D128V	probably benign	Het
Pappa	G	A	4: 65,335,764	V1552I	probably benign	Het
Pax8	A	T	2: 24,443,022	F103I	probably damaging	Het
Ptk2b	T	A	14: 66,174,755	S396C	probably damaging	Het
Rnf148	A	G	6: 23,654,170	Y276H	probably damaging	Het
Sec11c	A	T	18: 65,814,840	I93L	probably damaging	Het
Serpinb2	T	A	1: 107,523,180	N217K	probably benign	Het
Slc2a13	T	A	15: 91,572,902	T66S	probably damaging	Het
Slc4a3	T	C	1: 75,549,862	M9T	probably benign	Het
Sord	G	A	2: 122,256,942	V176I	possibly damaging	Het
Thbs4	G	A	13: 92,754,284	Q892*	probably null	Het
Thsd7b	T	A	1: 129,921,420	D956E	probably benign	Het
Tmem251	T	A	12: 102,744,172		probably null	Het
Topbp1	T	A	9: 103,308,977		probably null	Het
Tst	T	C	15: 78,405,253	E194G	probably damaging	Het
Ttk	T	A	9: 83,857,327	S484T	possibly damaging	Het
U2surp	A	G	9: 95,502,554	S26P	possibly damaging	Het
Ugt2b37	C	T	5: 87,240,855	A500T	probably benign	Het
Utrn	A	T	10: 12,670,186	Y1669*	probably null	Het
Wdr7	A	G	18: 63,987,160	N1424S	probably benign	Het
Xkr9	A	G	1: 13,701,379	D373G	probably benign	Het
Zfp984	T	A	4: 147,756,211	Y61F	probably benign	Het

Other mutations in Vmn2r23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Vmn2r23	APN	6	123729725	missense	possibly damaging	0.89
IGL01012:Vmn2r23	APN	6	123729596	missense	probably benign
IGL01073:Vmn2r23	APN	6	123712800	missense	possibly damaging	0.82
IGL01547:Vmn2r23	APN	6	123704424	missense	possibly damaging	0.88
IGL01571:Vmn2r23	APN	6	123704407	missense	probably damaging	1.00
IGL01950:Vmn2r23	APN	6	123741886	missense	possibly damaging	0.80
IGL02028:Vmn2r23	APN	6	123741860	missense	probably damaging	1.00
IGL02248:Vmn2r23	APN	6	123741744	missense	probably damaging	0.96
IGL02318:Vmn2r23	APN	6	123741836	missense	probably benign	0.10
IGL02649:Vmn2r23	APN	6	123704478	missense	probably benign
IGL02831:Vmn2r23	APN	6	123704385	missense	probably benign	0.22
IGL02832:Vmn2r23	APN	6	123704396	missense	probably benign	0.00
IGL02865:Vmn2r23	APN	6	123741619	missense	probably damaging	1.00
IGL02964:Vmn2r23	APN	6	123741782	missense	possibly damaging	0.93
IGL03347:Vmn2r23	APN	6	123704374	missense	probably benign	0.01
IGL03396:Vmn2r23	APN	6	123729626	missense	probably damaging	1.00
PIT4472001:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R0597:Vmn2r23	UTSW	6	123729721	missense	probably benign	0.08
R0677:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R0904:Vmn2r23	UTSW	6	123742135	missense	probably damaging	1.00
R1330:Vmn2r23	UTSW	6	123742004	missense	probably damaging	1.00
R1424:Vmn2r23	UTSW	6	123713270	nonsense	probably null
R1629:Vmn2r23	UTSW	6	123713427	missense	probably benign	0.05
R1842:Vmn2r23	UTSW	6	123729690	missense	possibly damaging	0.77
R1867:Vmn2r23	UTSW	6	123702915	missense	probably damaging	1.00
R1919:Vmn2r23	UTSW	6	123713010	missense	possibly damaging	0.94
R2087:Vmn2r23	UTSW	6	123741499	missense	probably benign	0.00
R2338:Vmn2r23	UTSW	6	123704425	missense	possibly damaging	0.88
R2568:Vmn2r23	UTSW	6	123742188	nonsense	probably null
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R3500:Vmn2r23	UTSW	6	123713170	missense	possibly damaging	0.81
R3789:Vmn2r23	UTSW	6	123741389	missense	probably damaging	1.00
R4164:Vmn2r23	UTSW	6	123729738	missense	probably benign
R4506:Vmn2r23	UTSW	6	123702925	missense	probably damaging	1.00
R4652:Vmn2r23	UTSW	6	123741730	missense	probably damaging	1.00
R4697:Vmn2r23	UTSW	6	123741826	missense	probably damaging	1.00
R4840:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R4983:Vmn2r23	UTSW	6	123733349	missense	probably damaging	1.00
R5276:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R5392:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R5528:Vmn2r23	UTSW	6	123713002	missense	probably damaging	1.00
R5529:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R5664:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R5749:Vmn2r23	UTSW	6	123733273	missense	probably benign
R5761:Vmn2r23	UTSW	6	123712759	missense	probably benign	0.39
R5762:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R5868:Vmn2r23	UTSW	6	123712942	missense	probably benign	0.12
R5935:Vmn2r23	UTSW	6	123741895	missense	possibly damaging	0.94
R6242:Vmn2r23	UTSW	6	123704400	missense	possibly damaging	0.82
R6416:Vmn2r23	UTSW	6	123712902	missense	probably damaging	1.00
R6524:Vmn2r23	UTSW	6	123713425	missense	probably damaging	1.00
R6576:Vmn2r23	UTSW	6	123733273	missense	probably benign
R6925:Vmn2r23	UTSW	6	123704553	missense	probably damaging	1.00
R7148:Vmn2r23	UTSW	6	123713022	missense	probably benign
R7215:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R7252:Vmn2r23	UTSW	6	123741581	missense	probably damaging	0.97
R7403:Vmn2r23	UTSW	6	123704579	missense	probably benign	0.01
R8015:Vmn2r23	UTSW	6	123704541	missense	probably benign	0.00
R8143:Vmn2r23	UTSW	6	123741353	missense	probably damaging	0.99
R8474:Vmn2r23	UTSW	6	123704640	missense	probably benign	0.36
R8679:Vmn2r23	UTSW	6	123713472	missense	probably damaging	0.99
R8713:Vmn2r23	UTSW	6	123703032	missense
R8966:Vmn2r23	UTSW	6	123742120	missense	possibly damaging	0.94
RF018:Vmn2r23	UTSW	6	123713116	missense	probably benign	0.00
T0975:Vmn2r23	UTSW	6	123713161	missense	probably benign	0.00
Z1088:Vmn2r23	UTSW	6	123742108	missense	probably damaging	0.98
Z1177:Vmn2r23	UTSW	6	123729725	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AGCTCTTTTGGTCTGCACG -3'
(R):5'- GGATATGTTCCCAGCCAGAC -3'

Sequencing Primer
(F):5'- GCACGGCCATTAGTTTATCTG -3'
(R):5'- TATGTTCCCAGCCAGACTGCAC -3'

Posted On

2021-01-18