Incidental Mutation 'R8520:Vmn2r23'
ID 658587
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
MMRRC Submission 067947-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8520 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 123679780-123719198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123718615 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 656 (Q656L)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect probably damaging
Transcript: ENSMUST00000172391
AA Change: Q656L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: Q656L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,838,423 (GRCm39) F136L possibly damaging Het
A430033K04Rik T A 5: 138,644,968 (GRCm39) N284K possibly damaging Het
Abcb1a T C 5: 8,735,346 (GRCm39) I151T possibly damaging Het
Adam28 C T 14: 68,879,532 (GRCm39) G172D probably damaging Het
Adcy6 A G 15: 98,502,041 (GRCm39) V191A probably benign Het
Ankrd52 T C 10: 128,225,359 (GRCm39) L911P probably damaging Het
C5ar1 A G 7: 15,982,076 (GRCm39) S315P probably damaging Het
Cubn A G 2: 13,313,331 (GRCm39) probably null Het
Dlec1 T C 9: 118,941,277 (GRCm39) S276P probably benign Het
Dnah14 T A 1: 181,481,203 (GRCm39) I1564N probably damaging Het
Dsg2 G A 18: 20,712,508 (GRCm39) G171R probably damaging Het
Dusp13b C A 14: 21,793,538 (GRCm39) G208* probably null Het
Ebf3 A C 7: 136,802,853 (GRCm39) probably null Het
Fbn2 A T 18: 58,171,270 (GRCm39) probably null Het
Fbxo27 A G 7: 28,392,767 (GRCm39) D16G probably benign Het
G6pc3 A G 11: 102,083,934 (GRCm39) S187G probably benign Het
Gucy2d G A 7: 98,121,513 (GRCm39) V995I probably null Het
Hmcn2 C A 2: 31,244,726 (GRCm39) P728T probably damaging Het
Il1r2 T C 1: 40,144,499 (GRCm39) L62P probably damaging Het
Ints7 T C 1: 191,314,603 (GRCm39) S63P probably damaging Het
Lyset T A 12: 102,710,431 (GRCm39) probably null Het
Mcf2l C A 8: 12,930,089 (GRCm39) D36E probably benign Het
Mfsd13b T G 7: 120,590,586 (GRCm39) I109S probably benign Het
Mier2 G A 10: 79,378,263 (GRCm39) H385Y possibly damaging Het
Mydgf C A 17: 56,490,734 (GRCm39) probably null Het
Nanog A T 6: 122,690,475 (GRCm39) L268F possibly damaging Het
Or12j5 T A 7: 140,084,315 (GRCm39) D19V probably benign Het
Or14a259 A T 7: 86,013,471 (GRCm39) C25S probably benign Het
Otud4 T A 8: 80,385,896 (GRCm39) N256K probably damaging Het
P2rx1 A T 11: 72,899,779 (GRCm39) D128V probably benign Het
Pappa G A 4: 65,254,001 (GRCm39) V1552I probably benign Het
Pax8 A T 2: 24,333,034 (GRCm39) F103I probably damaging Het
Ptk2b T A 14: 66,412,204 (GRCm39) S396C probably damaging Het
Rnf148 A G 6: 23,654,169 (GRCm39) Y276H probably damaging Het
Sec11c A T 18: 65,947,911 (GRCm39) I93L probably damaging Het
Serpinb2 T A 1: 107,450,910 (GRCm39) N217K probably benign Het
Slc2a13 T A 15: 91,457,105 (GRCm39) T66S probably damaging Het
Slc4a3 T C 1: 75,526,506 (GRCm39) M9T probably benign Het
Sord G A 2: 122,087,423 (GRCm39) V176I possibly damaging Het
Thbs4 G A 13: 92,890,792 (GRCm39) Q892* probably null Het
Thsd7b T A 1: 129,849,157 (GRCm39) D956E probably benign Het
Topbp1 T A 9: 103,186,176 (GRCm39) probably null Het
Tst T C 15: 78,289,453 (GRCm39) E194G probably damaging Het
Ttk T A 9: 83,739,380 (GRCm39) S484T possibly damaging Het
U2surp A G 9: 95,384,607 (GRCm39) S26P possibly damaging Het
Ugt2b37 C T 5: 87,388,714 (GRCm39) A500T probably benign Het
Utrn A T 10: 12,545,930 (GRCm39) Y1669* probably null Het
Wdr7 A G 18: 64,120,231 (GRCm39) N1424S probably benign Het
Xkr9 A G 1: 13,771,603 (GRCm39) D373G probably benign Het
Zfp984 T A 4: 147,840,668 (GRCm39) Y61F probably benign Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123,706,684 (GRCm39) missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123,706,555 (GRCm39) missense probably benign
IGL01073:Vmn2r23 APN 6 123,689,759 (GRCm39) missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123,681,383 (GRCm39) missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123,681,366 (GRCm39) missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123,718,845 (GRCm39) missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123,718,819 (GRCm39) missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123,718,703 (GRCm39) missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123,718,795 (GRCm39) missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123,681,437 (GRCm39) missense probably benign
IGL02831:Vmn2r23 APN 6 123,681,344 (GRCm39) missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123,681,355 (GRCm39) missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123,718,578 (GRCm39) missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123,718,741 (GRCm39) missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123,681,333 (GRCm39) missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123,706,585 (GRCm39) missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123,706,680 (GRCm39) missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123,719,094 (GRCm39) missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123,718,963 (GRCm39) missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123,690,229 (GRCm39) nonsense probably null
R1629:Vmn2r23 UTSW 6 123,690,386 (GRCm39) missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123,706,649 (GRCm39) missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123,679,874 (GRCm39) missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123,689,969 (GRCm39) missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123,718,458 (GRCm39) missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123,681,384 (GRCm39) missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123,719,147 (GRCm39) nonsense probably null
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123,690,129 (GRCm39) missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123,718,348 (GRCm39) missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123,706,697 (GRCm39) missense probably benign
R4506:Vmn2r23 UTSW 6 123,679,884 (GRCm39) missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123,718,689 (GRCm39) missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123,718,785 (GRCm39) missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123,710,308 (GRCm39) missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123,689,961 (GRCm39) missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R5761:Vmn2r23 UTSW 6 123,689,718 (GRCm39) missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123,689,901 (GRCm39) missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123,718,854 (GRCm39) missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123,681,359 (GRCm39) missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123,689,861 (GRCm39) missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123,690,384 (GRCm39) missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R6925:Vmn2r23 UTSW 6 123,681,512 (GRCm39) missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123,689,981 (GRCm39) missense probably benign
R7215:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123,718,540 (GRCm39) missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123,681,538 (GRCm39) missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123,681,500 (GRCm39) missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123,718,312 (GRCm39) missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123,681,599 (GRCm39) missense probably benign 0.36
R8679:Vmn2r23 UTSW 6 123,690,431 (GRCm39) missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123,679,991 (GRCm39) missense
R8966:Vmn2r23 UTSW 6 123,719,079 (GRCm39) missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123,719,038 (GRCm39) missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123,718,782 (GRCm39) missense probably damaging 1.00
R9189:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R9495:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
R9514:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
RF018:Vmn2r23 UTSW 6 123,690,075 (GRCm39) missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123,690,120 (GRCm39) missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123,719,067 (GRCm39) missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123,706,684 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGCTCTTTTGGTCTGCACG -3'
(R):5'- GGATATGTTCCCAGCCAGAC -3'

Sequencing Primer
(F):5'- GCACGGCCATTAGTTTATCTG -3'
(R):5'- TATGTTCCCAGCCAGACTGCAC -3'
Posted On 2021-01-18