Incidental Mutation 'R8520:C5ar1'
ID 658588
Institutional Source Beutler Lab
Gene Symbol C5ar1
Ensembl Gene ENSMUSG00000049130
Gene Name complement component 5a receptor 1
Synonyms C5aR, D7Msu1, Cd88, C5r1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock # R8520 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 16246743-16259540 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 16248151 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 315 (S315P)
Ref Sequence ENSEMBL: ENSMUSP00000129972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050770] [ENSMUST00000168818] [ENSMUST00000171425] [ENSMUST00000209442]
AlphaFold P30993
Predicted Effect probably damaging
Transcript: ENSMUST00000050770
AA Change: S315P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060003
Gene: ENSMUSG00000049130
AA Change: S315P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 48 312 2.2e-5 PFAM
Pfam:7tm_1 54 301 9.4e-41 PFAM
low complexity region 332 348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168818
AA Change: S315P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129972
Gene: ENSMUSG00000049130
AA Change: S315P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 48 312 2e-5 PFAM
Pfam:7tm_1 54 301 9.2e-52 PFAM
low complexity region 332 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171425
SMART Domains Protein: ENSMUSP00000133056
Gene: ENSMUSG00000074361

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
low complexity region 53 68 N/A INTRINSIC
Pfam:7tm_1 72 257 7e-21 PFAM
Pfam:7tm_1 243 311 8.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209442
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Homozygous targeted mutants have impaired C5 responses that can show increased or decreased acute inflammation under different circumstances, and thus affect severity of disease or infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,609 F136L possibly damaging Het
A430033K04Rik T A 5: 138,646,706 N284K possibly damaging Het
Abcb1a T C 5: 8,685,346 I151T possibly damaging Het
Adam28 C T 14: 68,642,083 G172D probably damaging Het
Adcy6 A G 15: 98,604,160 V191A probably benign Het
Ankrd52 T C 10: 128,389,490 L911P probably damaging Het
Cubn A G 2: 13,308,520 probably null Het
Dlec1 T C 9: 119,112,209 S276P probably benign Het
Dnah14 T A 1: 181,653,638 I1564N probably damaging Het
Dsg2 G A 18: 20,579,451 G171R probably damaging Het
Dusp13 C A 14: 21,743,470 G208* probably null Het
Ebf3 A C 7: 137,201,124 probably null Het
Fbn2 A T 18: 58,038,198 probably null Het
Fbxo27 A G 7: 28,693,342 D16G probably benign Het
G6pc3 A G 11: 102,193,108 S187G probably benign Het
Gucy2d G A 7: 98,472,306 V995I probably null Het
Hmcn2 C A 2: 31,354,714 P728T probably damaging Het
Il1r2 T C 1: 40,105,339 L62P probably damaging Het
Ints7 T C 1: 191,582,491 S63P probably damaging Het
Mcf2l C A 8: 12,880,089 D36E probably benign Het
Mfsd13b T G 7: 120,991,363 I109S probably benign Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Mydgf C A 17: 56,183,734 probably null Het
Nanog A T 6: 122,713,516 L268F possibly damaging Het
Olfr305 A T 7: 86,364,263 C25S probably benign Het
Olfr536 T A 7: 140,504,402 D19V probably benign Het
Otud4 T A 8: 79,659,267 N256K probably damaging Het
P2rx1 A T 11: 73,008,953 D128V probably benign Het
Pappa G A 4: 65,335,764 V1552I probably benign Het
Pax8 A T 2: 24,443,022 F103I probably damaging Het
Ptk2b T A 14: 66,174,755 S396C probably damaging Het
Rnf148 A G 6: 23,654,170 Y276H probably damaging Het
Sec11c A T 18: 65,814,840 I93L probably damaging Het
Serpinb2 T A 1: 107,523,180 N217K probably benign Het
Slc2a13 T A 15: 91,572,902 T66S probably damaging Het
Slc4a3 T C 1: 75,549,862 M9T probably benign Het
Sord G A 2: 122,256,942 V176I possibly damaging Het
Thbs4 G A 13: 92,754,284 Q892* probably null Het
Thsd7b T A 1: 129,921,420 D956E probably benign Het
Tmem251 T A 12: 102,744,172 probably null Het
Topbp1 T A 9: 103,308,977 probably null Het
Tst T C 15: 78,405,253 E194G probably damaging Het
Ttk T A 9: 83,857,327 S484T possibly damaging Het
U2surp A G 9: 95,502,554 S26P possibly damaging Het
Ugt2b37 C T 5: 87,240,855 A500T probably benign Het
Utrn A T 10: 12,670,186 Y1669* probably null Het
Vmn2r23 A T 6: 123,741,656 Q656L probably damaging Het
Wdr7 A G 18: 63,987,160 N1424S probably benign Het
Xkr9 A G 1: 13,701,379 D373G probably benign Het
Zfp984 T A 4: 147,756,211 Y61F probably benign Het
Other mutations in C5ar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0135:C5ar1 UTSW 7 16248939 missense probably damaging 1.00
R1338:C5ar1 UTSW 7 16248335 missense probably damaging 1.00
R1527:C5ar1 UTSW 7 16248193 missense probably damaging 1.00
R4477:C5ar1 UTSW 7 16248864 missense probably damaging 1.00
R4812:C5ar1 UTSW 7 16248333 splice site probably null
R5795:C5ar1 UTSW 7 16248394 missense possibly damaging 0.73
R5963:C5ar1 UTSW 7 16248822 missense possibly damaging 0.60
R6993:C5ar1 UTSW 7 16248912 missense probably damaging 1.00
R7294:C5ar1 UTSW 7 16249025 missense probably benign 0.00
R7464:C5ar1 UTSW 7 16248766 missense probably benign 0.07
R7619:C5ar1 UTSW 7 16248579 missense probably damaging 1.00
R8934:C5ar1 UTSW 7 16248477 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTCAGAGCAACTTAGAGAATTGC -3'
(R):5'- ACGCTCAAAGTGGTGATGGC -3'

Sequencing Primer
(F):5'- TTGCAGAAAATTAAACATGCAAAGAG -3'
(R):5'- ATCTTCTGGCTGCCCTATCAGG -3'
Posted On 2021-01-18