Incidental Mutation 'R8520:Olfr305'
ID 658590
Institutional Source Beutler Lab
Gene Symbol Olfr305
Ensembl Gene ENSMUSG00000055571
Gene Name olfactory receptor 305
Synonyms MOR219-2, GA_x6K02T2NHDJ-9744055-9745014
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R8520 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 86360854-86366928 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86364263 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 25 (C25S)
Ref Sequence ENSEMBL: ENSMUSP00000149883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069236] [ENSMUST00000213255] [ENSMUST00000213869] [ENSMUST00000216700]
AlphaFold Q7TS02
Predicted Effect probably benign
Transcript: ENSMUST00000069236
AA Change: C25S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000068650
Gene: ENSMUSG00000055571
AA Change: C25S

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-40 PFAM
Pfam:7tm_1 39 288 3.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213255
AA Change: C25S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000213869
AA Change: C25S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000216700
AA Change: C25S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,609 F136L possibly damaging Het
A430033K04Rik T A 5: 138,646,706 N284K possibly damaging Het
Abcb1a T C 5: 8,685,346 I151T possibly damaging Het
Adam28 C T 14: 68,642,083 G172D probably damaging Het
Adcy6 A G 15: 98,604,160 V191A probably benign Het
Ankrd52 T C 10: 128,389,490 L911P probably damaging Het
C5ar1 A G 7: 16,248,151 S315P probably damaging Het
Cubn A G 2: 13,308,520 probably null Het
Dlec1 T C 9: 119,112,209 S276P probably benign Het
Dnah14 T A 1: 181,653,638 I1564N probably damaging Het
Dsg2 G A 18: 20,579,451 G171R probably damaging Het
Dusp13 C A 14: 21,743,470 G208* probably null Het
Ebf3 A C 7: 137,201,124 probably null Het
Fbn2 A T 18: 58,038,198 probably null Het
Fbxo27 A G 7: 28,693,342 D16G probably benign Het
G6pc3 A G 11: 102,193,108 S187G probably benign Het
Gucy2d G A 7: 98,472,306 V995I probably null Het
Hmcn2 C A 2: 31,354,714 P728T probably damaging Het
Il1r2 T C 1: 40,105,339 L62P probably damaging Het
Ints7 T C 1: 191,582,491 S63P probably damaging Het
Mcf2l C A 8: 12,880,089 D36E probably benign Het
Mfsd13b T G 7: 120,991,363 I109S probably benign Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Mydgf C A 17: 56,183,734 probably null Het
Nanog A T 6: 122,713,516 L268F possibly damaging Het
Olfr536 T A 7: 140,504,402 D19V probably benign Het
Otud4 T A 8: 79,659,267 N256K probably damaging Het
P2rx1 A T 11: 73,008,953 D128V probably benign Het
Pappa G A 4: 65,335,764 V1552I probably benign Het
Pax8 A T 2: 24,443,022 F103I probably damaging Het
Ptk2b T A 14: 66,174,755 S396C probably damaging Het
Rnf148 A G 6: 23,654,170 Y276H probably damaging Het
Sec11c A T 18: 65,814,840 I93L probably damaging Het
Serpinb2 T A 1: 107,523,180 N217K probably benign Het
Slc2a13 T A 15: 91,572,902 T66S probably damaging Het
Slc4a3 T C 1: 75,549,862 M9T probably benign Het
Sord G A 2: 122,256,942 V176I possibly damaging Het
Thbs4 G A 13: 92,754,284 Q892* probably null Het
Thsd7b T A 1: 129,921,420 D956E probably benign Het
Tmem251 T A 12: 102,744,172 probably null Het
Topbp1 T A 9: 103,308,977 probably null Het
Tst T C 15: 78,405,253 E194G probably damaging Het
Ttk T A 9: 83,857,327 S484T possibly damaging Het
U2surp A G 9: 95,502,554 S26P possibly damaging Het
Ugt2b37 C T 5: 87,240,855 A500T probably benign Het
Utrn A T 10: 12,670,186 Y1669* probably null Het
Vmn2r23 A T 6: 123,741,656 Q656L probably damaging Het
Wdr7 A G 18: 63,987,160 N1424S probably benign Het
Xkr9 A G 1: 13,701,379 D373G probably benign Het
Zfp984 T A 4: 147,756,211 Y61F probably benign Het
Other mutations in Olfr305
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Olfr305 APN 7 86363560 missense possibly damaging 0.46
IGL02102:Olfr305 APN 7 86363866 missense probably benign 0.25
IGL02424:Olfr305 APN 7 86363480 missense probably benign 0.02
IGL02664:Olfr305 APN 7 86363603 missense possibly damaging 0.94
IGL03167:Olfr305 APN 7 86363920 missense probably damaging 1.00
R0035:Olfr305 UTSW 7 86364187 missense possibly damaging 0.95
R0373:Olfr305 UTSW 7 86363805 nonsense probably null
R0510:Olfr305 UTSW 7 86363827 missense probably benign 0.21
R2214:Olfr305 UTSW 7 86364206 missense probably benign 0.01
R3147:Olfr305 UTSW 7 86363884 missense probably benign 0.01
R3623:Olfr305 UTSW 7 86364100 missense probably benign 0.02
R4155:Olfr305 UTSW 7 86364062 missense probably benign 0.00
R4332:Olfr305 UTSW 7 86363872 missense probably benign 0.01
R4785:Olfr305 UTSW 7 86363735 missense probably damaging 1.00
R4834:Olfr305 UTSW 7 86363744 missense probably benign 0.21
R4871:Olfr305 UTSW 7 86363484 missense probably damaging 1.00
R5161:Olfr305 UTSW 7 86364338 splice site probably null
R5254:Olfr305 UTSW 7 86364190 missense possibly damaging 0.82
R6430:Olfr305 UTSW 7 86363973 nonsense probably null
R7734:Olfr305 UTSW 7 86364268 missense not run
R8682:Olfr305 UTSW 7 86364165 missense probably damaging 0.99
R9407:Olfr305 UTSW 7 86363986 nonsense probably null
RF010:Olfr305 UTSW 7 86363386 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACCTGAAATGCACATCCAAGTATG -3'
(R):5'- CGTAATTTAGGTAGTTTCCTGACTC -3'

Sequencing Primer
(F):5'- TGTGCATAAGGCTATTGACAAAG -3'
(R):5'- AGGTAGTTTCCTGACTCTTTTCCAC -3'
Posted On 2021-01-18