Incidental Mutation 'R8520:Olfr536'
ID 658594
Institutional Source Beutler Lab
Gene Symbol Olfr536
Ensembl Gene ENSMUSG00000052508
Gene Name olfactory receptor 536
Synonyms GA_x6K02T2PBJ9-42653501-42652578, MOR252-1, MOR252-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R8520 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 140500849-140507396 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 140504402 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 19 (D19V)
Ref Sequence ENSEMBL: ENSMUSP00000149758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064392] [ENSMUST00000209873] [ENSMUST00000215340] [ENSMUST00000215768]
AlphaFold Q8VFE9
Predicted Effect probably benign
Transcript: ENSMUST00000064392
AA Change: D19V

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000067699
Gene: ENSMUSG00000052508
AA Change: D19V

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 8.7e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 304 5.4e-6 PFAM
Pfam:7tm_1 41 289 3.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209873
AA Change: D19V

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000215340
AA Change: D19V

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000215768
AA Change: D19V

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,609 F136L possibly damaging Het
A430033K04Rik T A 5: 138,646,706 N284K possibly damaging Het
Abcb1a T C 5: 8,685,346 I151T possibly damaging Het
Adam28 C T 14: 68,642,083 G172D probably damaging Het
Adcy6 A G 15: 98,604,160 V191A probably benign Het
Ankrd52 T C 10: 128,389,490 L911P probably damaging Het
C5ar1 A G 7: 16,248,151 S315P probably damaging Het
Cubn A G 2: 13,308,520 probably null Het
Dlec1 T C 9: 119,112,209 S276P probably benign Het
Dnah14 T A 1: 181,653,638 I1564N probably damaging Het
Dsg2 G A 18: 20,579,451 G171R probably damaging Het
Dusp13 C A 14: 21,743,470 G208* probably null Het
Ebf3 A C 7: 137,201,124 probably null Het
Fbn2 A T 18: 58,038,198 probably null Het
Fbxo27 A G 7: 28,693,342 D16G probably benign Het
G6pc3 A G 11: 102,193,108 S187G probably benign Het
Gucy2d G A 7: 98,472,306 V995I probably null Het
Hmcn2 C A 2: 31,354,714 P728T probably damaging Het
Il1r2 T C 1: 40,105,339 L62P probably damaging Het
Ints7 T C 1: 191,582,491 S63P probably damaging Het
Mcf2l C A 8: 12,880,089 D36E probably benign Het
Mfsd13b T G 7: 120,991,363 I109S probably benign Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Mydgf C A 17: 56,183,734 probably null Het
Nanog A T 6: 122,713,516 L268F possibly damaging Het
Olfr305 A T 7: 86,364,263 C25S probably benign Het
Otud4 T A 8: 79,659,267 N256K probably damaging Het
P2rx1 A T 11: 73,008,953 D128V probably benign Het
Pappa G A 4: 65,335,764 V1552I probably benign Het
Pax8 A T 2: 24,443,022 F103I probably damaging Het
Ptk2b T A 14: 66,174,755 S396C probably damaging Het
Rnf148 A G 6: 23,654,170 Y276H probably damaging Het
Sec11c A T 18: 65,814,840 I93L probably damaging Het
Serpinb2 T A 1: 107,523,180 N217K probably benign Het
Slc2a13 T A 15: 91,572,902 T66S probably damaging Het
Slc4a3 T C 1: 75,549,862 M9T probably benign Het
Sord G A 2: 122,256,942 V176I possibly damaging Het
Thbs4 G A 13: 92,754,284 Q892* probably null Het
Thsd7b T A 1: 129,921,420 D956E probably benign Het
Tmem251 T A 12: 102,744,172 probably null Het
Topbp1 T A 9: 103,308,977 probably null Het
Tst T C 15: 78,405,253 E194G probably damaging Het
Ttk T A 9: 83,857,327 S484T possibly damaging Het
U2surp A G 9: 95,502,554 S26P possibly damaging Het
Ugt2b37 C T 5: 87,240,855 A500T probably benign Het
Utrn A T 10: 12,670,186 Y1669* probably null Het
Vmn2r23 A T 6: 123,741,656 Q656L probably damaging Het
Wdr7 A G 18: 63,987,160 N1424S probably benign Het
Xkr9 A G 1: 13,701,379 D373G probably benign Het
Zfp984 T A 4: 147,756,211 Y61F probably benign Het
Other mutations in Olfr536
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Olfr536 APN 7 140504184 missense probably damaging 1.00
IGL02065:Olfr536 APN 7 140504164 missense probably benign 0.02
IGL02812:Olfr536 APN 7 140503620 missense probably damaging 0.99
IGL02896:Olfr536 APN 7 140504055 splice site probably null
IGL03281:Olfr536 APN 7 140503800 missense probably damaging 1.00
R2440:Olfr536 UTSW 7 140503552 missense probably benign 0.25
R3110:Olfr536 UTSW 7 140503919 missense probably damaging 0.99
R3112:Olfr536 UTSW 7 140503919 missense probably damaging 0.99
R4349:Olfr536 UTSW 7 140504357 nonsense probably null
R4660:Olfr536 UTSW 7 140504020 missense probably benign 0.03
R4827:Olfr536 UTSW 7 140503670 missense probably damaging 0.96
R5606:Olfr536 UTSW 7 140503800 missense probably damaging 1.00
R5607:Olfr536 UTSW 7 140504405 missense probably benign 0.10
R7102:Olfr536 UTSW 7 140504316 missense probably benign 0.05
R7354:Olfr536 UTSW 7 140504186 missense probably damaging 1.00
R8081:Olfr536 UTSW 7 140504456 start codon destroyed probably null 1.00
R8095:Olfr536 UTSW 7 140504279 missense probably damaging 1.00
R8880:Olfr536 UTSW 7 140504259 missense probably benign 0.00
R9124:Olfr536 UTSW 7 140504309 missense probably benign
Z1088:Olfr536 UTSW 7 140503805 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACTTTGGGCAAGACAGTCAC -3'
(R):5'- GACCTGCTATTTTCATTACCCTGAG -3'

Sequencing Primer
(F):5'- CAGTGCAGATCATATCCATCAGGG -3'
(R):5'- TCATTACCCTGAGAGACATGAATGAG -3'
Posted On 2021-01-18