Incidental Mutation 'R8520:Ttk'
ID 658597
Institutional Source Beutler Lab
Gene Symbol Ttk
Ensembl Gene ENSMUSG00000038379
Gene Name Ttk protein kinase
Synonyms Mps1, Esk1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock # R8520 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 83834689-83872389 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 83857327 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 484 (S484T)
Ref Sequence ENSEMBL: ENSMUSP00000064839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070326] [ENSMUST00000185913]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000070326
AA Change: S484T

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064839
Gene: ENSMUSG00000038379
AA Change: S484T

DomainStartEndE-ValueType
PDB:4B94|D 55 235 7e-97 PDB
low complexity region 459 487 N/A INTRINSIC
S_TKc 498 764 1.14e-77 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000185913
AA Change: S484T

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139956
Gene: ENSMUSG00000038379
AA Change: S484T

DomainStartEndE-ValueType
PDB:4B94|D 55 235 2e-97 PDB
low complexity region 459 487 N/A INTRINSIC
Pfam:Pkinase 498 661 7.9e-36 PFAM
Pfam:Pkinase_Tyr 498 661 6.8e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual specificity protein kinase with the ability to phosphorylate tyrosine, serine and threonine. Associated with cell proliferation, this protein is essential for chromosome alignment at the centromere during mitosis and is required for centrosome duplication. It has been found to be a critical mitotic checkpoint protein for accurate segregation of chromosomes during mitosis. Tumorigenesis may occur when this protein fails to degrade and produces excess centrosomes resulting in aberrant mitotic spindles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a floxed allele activated in oocytes exhibit reduced female fertility associated with defective spindle assembly checkpoint, premature chromosome segregation, and accelerated anaphase and polar body extrusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,609 F136L possibly damaging Het
A430033K04Rik T A 5: 138,646,706 N284K possibly damaging Het
Abcb1a T C 5: 8,685,346 I151T possibly damaging Het
Adam28 C T 14: 68,642,083 G172D probably damaging Het
Adcy6 A G 15: 98,604,160 V191A probably benign Het
Ankrd52 T C 10: 128,389,490 L911P probably damaging Het
C5ar1 A G 7: 16,248,151 S315P probably damaging Het
Cubn A G 2: 13,308,520 probably null Het
Dlec1 T C 9: 119,112,209 S276P probably benign Het
Dnah14 T A 1: 181,653,638 I1564N probably damaging Het
Dsg2 G A 18: 20,579,451 G171R probably damaging Het
Dusp13 C A 14: 21,743,470 G208* probably null Het
Ebf3 A C 7: 137,201,124 probably null Het
Fbn2 A T 18: 58,038,198 probably null Het
Fbxo27 A G 7: 28,693,342 D16G probably benign Het
G6pc3 A G 11: 102,193,108 S187G probably benign Het
Gucy2d G A 7: 98,472,306 V995I probably null Het
Hmcn2 C A 2: 31,354,714 P728T probably damaging Het
Il1r2 T C 1: 40,105,339 L62P probably damaging Het
Ints7 T C 1: 191,582,491 S63P probably damaging Het
Mcf2l C A 8: 12,880,089 D36E probably benign Het
Mfsd13b T G 7: 120,991,363 I109S probably benign Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Mydgf C A 17: 56,183,734 probably null Het
Nanog A T 6: 122,713,516 L268F possibly damaging Het
Olfr305 A T 7: 86,364,263 C25S probably benign Het
Olfr536 T A 7: 140,504,402 D19V probably benign Het
Otud4 T A 8: 79,659,267 N256K probably damaging Het
P2rx1 A T 11: 73,008,953 D128V probably benign Het
Pappa G A 4: 65,335,764 V1552I probably benign Het
Pax8 A T 2: 24,443,022 F103I probably damaging Het
Ptk2b T A 14: 66,174,755 S396C probably damaging Het
Rnf148 A G 6: 23,654,170 Y276H probably damaging Het
Sec11c A T 18: 65,814,840 I93L probably damaging Het
Serpinb2 T A 1: 107,523,180 N217K probably benign Het
Slc2a13 T A 15: 91,572,902 T66S probably damaging Het
Slc4a3 T C 1: 75,549,862 M9T probably benign Het
Sord G A 2: 122,256,942 V176I possibly damaging Het
Thbs4 G A 13: 92,754,284 Q892* probably null Het
Thsd7b T A 1: 129,921,420 D956E probably benign Het
Tmem251 T A 12: 102,744,172 probably null Het
Topbp1 T A 9: 103,308,977 probably null Het
Tst T C 15: 78,405,253 E194G probably damaging Het
U2surp A G 9: 95,502,554 S26P possibly damaging Het
Ugt2b37 C T 5: 87,240,855 A500T probably benign Het
Utrn A T 10: 12,670,186 Y1669* probably null Het
Vmn2r23 A T 6: 123,741,656 Q656L probably damaging Het
Wdr7 A G 18: 63,987,160 N1424S probably benign Het
Xkr9 A G 1: 13,701,379 D373G probably benign Het
Zfp984 T A 4: 147,756,211 Y61F probably benign Het
Other mutations in Ttk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00721:Ttk APN 9 83863448 missense probably damaging 1.00
IGL01298:Ttk APN 9 83865142 missense probably benign 0.27
IGL02806:Ttk APN 9 83862487 nonsense probably null
IGL03080:Ttk APN 9 83843083 missense probably damaging 1.00
R0396:Ttk UTSW 9 83847260 unclassified probably benign
R0507:Ttk UTSW 9 83868067 missense probably damaging 0.97
R0827:Ttk UTSW 9 83843915 missense probably benign
R1077:Ttk UTSW 9 83844149 unclassified probably benign
R1730:Ttk UTSW 9 83868592 missense possibly damaging 0.86
R1844:Ttk UTSW 9 83854862 missense possibly damaging 0.55
R1856:Ttk UTSW 9 83869263 missense probably damaging 1.00
R1941:Ttk UTSW 9 83853126 missense probably benign 0.22
R2191:Ttk UTSW 9 83862183 missense probably damaging 0.99
R3737:Ttk UTSW 9 83854837 missense possibly damaging 0.88
R4035:Ttk UTSW 9 83854837 missense possibly damaging 0.88
R4903:Ttk UTSW 9 83865148 missense probably benign 0.42
R4908:Ttk UTSW 9 83843686 missense possibly damaging 0.96
R4966:Ttk UTSW 9 83865148 missense probably benign 0.42
R5023:Ttk UTSW 9 83863541 missense probably damaging 1.00
R5197:Ttk UTSW 9 83839341 missense probably benign
R5567:Ttk UTSW 9 83862535 missense possibly damaging 0.94
R6022:Ttk UTSW 9 83839322 missense probably damaging 1.00
R6900:Ttk UTSW 9 83872030 missense probably damaging 0.96
R7039:Ttk UTSW 9 83868092 missense probably damaging 1.00
R7373:Ttk UTSW 9 83854877 missense probably benign 0.00
R7715:Ttk UTSW 9 83865153 missense probably benign 0.10
R7846:Ttk UTSW 9 83843679 missense probably benign 0.27
R8189:Ttk UTSW 9 83847219 missense probably benign 0.38
R8880:Ttk UTSW 9 83869251 missense probably damaging 1.00
R8903:Ttk UTSW 9 83868060 missense probably damaging 1.00
R8919:Ttk UTSW 9 83839269 missense probably damaging 1.00
R9105:Ttk UTSW 9 83863491 missense probably damaging 1.00
R9142:Ttk UTSW 9 83843688 missense probably damaging 0.99
R9434:Ttk UTSW 9 83868090 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGACCTTTGAGAAATTTGTCTCTG -3'
(R):5'- GGAGGATATGAGGCAGCTTTTC -3'

Sequencing Primer
(F):5'- ACTCCTCATTTATGTTTTGTTGGTG -3'
(R):5'- CAGCTTTTCTGGCTCCAGGG -3'
Posted On 2021-01-18