Incidental Mutation 'R8520:Ankrd52'
ID 658602
Institutional Source Beutler Lab
Gene Symbol Ankrd52
Ensembl Gene ENSMUSG00000014498
Gene Name ankyrin repeat domain 52
Synonyms G431002C21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock # R8520 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 128377115-128408704 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128389490 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 911 (L911P)
Ref Sequence ENSEMBL: ENSMUSP00000014642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014642]
AlphaFold Q8BTI7
Predicted Effect probably damaging
Transcript: ENSMUST00000014642
AA Change: L911P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014642
Gene: ENSMUSG00000014498
AA Change: L911P

DomainStartEndE-ValueType
ANK 7 36 4.44e2 SMART
ANK 40 69 6.55e-5 SMART
ANK 73 102 1.03e-2 SMART
ANK 106 135 1.5e1 SMART
ANK 139 168 5.49e-7 SMART
ANK 172 201 3.01e-4 SMART
ANK 205 234 1.2e-3 SMART
ANK 238 267 2.62e-4 SMART
ANK 271 301 9.78e-4 SMART
ANK 305 334 3.85e-2 SMART
ANK 338 367 5.62e-4 SMART
ANK 371 402 1.55e2 SMART
ANK 422 451 2.16e-5 SMART
ANK 455 484 3.28e-5 SMART
ANK 488 545 2.79e1 SMART
ANK 549 578 5.45e-2 SMART
ANK 584 613 1.84e1 SMART
ANK 617 646 3.85e-2 SMART
ANK 651 682 2.1e-3 SMART
ANK 687 716 6.76e-7 SMART
ANK 720 749 1.07e0 SMART
ANK 753 784 2.92e-2 SMART
ANK 790 819 1.12e-3 SMART
ANK 822 853 9.75e1 SMART
ANK 857 886 1.99e-4 SMART
ANK 890 920 5.09e-2 SMART
ANK 924 953 2.54e-2 SMART
ANK 960 989 1.34e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166577
AA Change: L38P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128794
Gene: ENSMUSG00000014498
AA Change: L38P

DomainStartEndE-ValueType
ANK 18 48 5.09e-2 SMART
ANK 52 81 2.54e-2 SMART
ANK 88 117 1.34e-1 SMART
Blast:ANK 121 148 3e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,609 F136L possibly damaging Het
A430033K04Rik T A 5: 138,646,706 N284K possibly damaging Het
Abcb1a T C 5: 8,685,346 I151T possibly damaging Het
Adam28 C T 14: 68,642,083 G172D probably damaging Het
Adcy6 A G 15: 98,604,160 V191A probably benign Het
C5ar1 A G 7: 16,248,151 S315P probably damaging Het
Cubn A G 2: 13,308,520 probably null Het
Dlec1 T C 9: 119,112,209 S276P probably benign Het
Dnah14 T A 1: 181,653,638 I1564N probably damaging Het
Dsg2 G A 18: 20,579,451 G171R probably damaging Het
Dusp13 C A 14: 21,743,470 G208* probably null Het
Ebf3 A C 7: 137,201,124 probably null Het
Fbn2 A T 18: 58,038,198 probably null Het
Fbxo27 A G 7: 28,693,342 D16G probably benign Het
G6pc3 A G 11: 102,193,108 S187G probably benign Het
Gucy2d G A 7: 98,472,306 V995I probably null Het
Hmcn2 C A 2: 31,354,714 P728T probably damaging Het
Il1r2 T C 1: 40,105,339 L62P probably damaging Het
Ints7 T C 1: 191,582,491 S63P probably damaging Het
Mcf2l C A 8: 12,880,089 D36E probably benign Het
Mfsd13b T G 7: 120,991,363 I109S probably benign Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Mydgf C A 17: 56,183,734 probably null Het
Nanog A T 6: 122,713,516 L268F possibly damaging Het
Olfr305 A T 7: 86,364,263 C25S probably benign Het
Olfr536 T A 7: 140,504,402 D19V probably benign Het
Otud4 T A 8: 79,659,267 N256K probably damaging Het
P2rx1 A T 11: 73,008,953 D128V probably benign Het
Pappa G A 4: 65,335,764 V1552I probably benign Het
Pax8 A T 2: 24,443,022 F103I probably damaging Het
Ptk2b T A 14: 66,174,755 S396C probably damaging Het
Rnf148 A G 6: 23,654,170 Y276H probably damaging Het
Sec11c A T 18: 65,814,840 I93L probably damaging Het
Serpinb2 T A 1: 107,523,180 N217K probably benign Het
Slc2a13 T A 15: 91,572,902 T66S probably damaging Het
Slc4a3 T C 1: 75,549,862 M9T probably benign Het
Sord G A 2: 122,256,942 V176I possibly damaging Het
Thbs4 G A 13: 92,754,284 Q892* probably null Het
Thsd7b T A 1: 129,921,420 D956E probably benign Het
Tmem251 T A 12: 102,744,172 probably null Het
Topbp1 T A 9: 103,308,977 probably null Het
Tst T C 15: 78,405,253 E194G probably damaging Het
Ttk T A 9: 83,857,327 S484T possibly damaging Het
U2surp A G 9: 95,502,554 S26P possibly damaging Het
Ugt2b37 C T 5: 87,240,855 A500T probably benign Het
Utrn A T 10: 12,670,186 Y1669* probably null Het
Vmn2r23 A T 6: 123,741,656 Q656L probably damaging Het
Wdr7 A G 18: 63,987,160 N1424S probably benign Het
Xkr9 A G 1: 13,701,379 D373G probably benign Het
Zfp984 T A 4: 147,756,211 Y61F probably benign Het
Other mutations in Ankrd52
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0014:Ankrd52 UTSW 10 128386452 missense probably benign 0.37
R0014:Ankrd52 UTSW 10 128386452 missense probably benign 0.37
R0139:Ankrd52 UTSW 10 128386138 missense probably benign 0.35
R0226:Ankrd52 UTSW 10 128389858 splice site probably null
R1355:Ankrd52 UTSW 10 128388696 missense possibly damaging 0.48
R1370:Ankrd52 UTSW 10 128388696 missense possibly damaging 0.48
R2190:Ankrd52 UTSW 10 128383618 missense probably benign 0.01
R2566:Ankrd52 UTSW 10 128389351 missense probably benign 0.39
R3884:Ankrd52 UTSW 10 128388955 missense probably damaging 0.96
R4624:Ankrd52 UTSW 10 128389259 missense probably damaging 1.00
R4706:Ankrd52 UTSW 10 128378161 missense probably benign
R4750:Ankrd52 UTSW 10 128378089 missense probably damaging 1.00
R4790:Ankrd52 UTSW 10 128380945 missense possibly damaging 0.62
R4965:Ankrd52 UTSW 10 128390507 missense probably benign 0.08
R5060:Ankrd52 UTSW 10 128389841 missense possibly damaging 0.87
R5446:Ankrd52 UTSW 10 128388561 missense probably damaging 1.00
R5798:Ankrd52 UTSW 10 128387610 missense probably benign 0.01
R5977:Ankrd52 UTSW 10 128382697 missense probably damaging 1.00
R5998:Ankrd52 UTSW 10 128383123 missense probably damaging 1.00
R6107:Ankrd52 UTSW 10 128387012 missense probably benign 0.19
R6478:Ankrd52 UTSW 10 128379331 splice site probably null
R6579:Ankrd52 UTSW 10 128387142 missense probably damaging 1.00
R6937:Ankrd52 UTSW 10 128387020 missense probably benign 0.42
R7078:Ankrd52 UTSW 10 128383657 missense probably benign 0.01
R7101:Ankrd52 UTSW 10 128382380 missense probably damaging 1.00
R7252:Ankrd52 UTSW 10 128381996 missense probably damaging 1.00
R7324:Ankrd52 UTSW 10 128386163 missense possibly damaging 0.74
R7505:Ankrd52 UTSW 10 128390055 missense probably damaging 0.99
R7979:Ankrd52 UTSW 10 128381988 missense probably damaging 1.00
R8178:Ankrd52 UTSW 10 128389301 missense probably damaging 1.00
R8985:Ankrd52 UTSW 10 128387109 missense probably damaging 1.00
R9068:Ankrd52 UTSW 10 128381981 missense probably damaging 1.00
X0028:Ankrd52 UTSW 10 128381851 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGCCGAAGTGAATGCCAC -3'
(R):5'- AGGTACTTGGAACAGAAGCC -3'

Sequencing Primer
(F):5'- GAAGTGAATGCCACCGACC -3'
(R):5'- GAGACATGCTTCACCAGTCAGG -3'
Posted On 2021-01-18