Incidental Mutation 'R8520:P2rx1'
ID 658603
Institutional Source Beutler Lab
Gene Symbol P2rx1
Ensembl Gene ENSMUSG00000020787
Gene Name purinergic receptor P2X, ligand-gated ion channel, 1
Synonyms P2X1 receptor, P2x, Pdcd3, RP-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R8520 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 72999103-73015200 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 73008953 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 128 (D128V)
Ref Sequence ENSEMBL: ENSMUSP00000090614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021141] [ENSMUST00000092938]
AlphaFold P51576
Predicted Effect probably benign
Transcript: ENSMUST00000021141
AA Change: D128V

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000021141
Gene: ENSMUSG00000020787
AA Change: D128V

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 376 1.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092938
AA Change: D128V

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000090614
Gene: ENSMUSG00000020787
AA Change: D128V

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 182 1.1e-71 PFAM
Pfam:P2X_receptor 171 355 2.1e-76 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the P2X family of G-protein-coupled receptors. These proteins can form homo-and heterotimers and function as ATP-gated ion channels and mediate rapid and selective permeability to cations. This protein is primarily localized to smooth muscle where binds ATP and mediates synaptic transmission between neurons and from neurons to smooth muscle and may being responsible for sympathetic vasoconstriction in small arteries, arterioles and vas deferens. Mouse studies suggest that this receptor is essential for normal male reproductive function. This protein may also be involved in promoting apoptosis. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit low male fertility due to impaired vas deferens contraction and reduced numbers of ejaculated sperm. Mutants also show mild hypertension and reduced susceptibility to experimental thromboembolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,609 F136L possibly damaging Het
A430033K04Rik T A 5: 138,646,706 N284K possibly damaging Het
Abcb1a T C 5: 8,685,346 I151T possibly damaging Het
Adam28 C T 14: 68,642,083 G172D probably damaging Het
Adcy6 A G 15: 98,604,160 V191A probably benign Het
Ankrd52 T C 10: 128,389,490 L911P probably damaging Het
C5ar1 A G 7: 16,248,151 S315P probably damaging Het
Cubn A G 2: 13,308,520 probably null Het
Dlec1 T C 9: 119,112,209 S276P probably benign Het
Dnah14 T A 1: 181,653,638 I1564N probably damaging Het
Dsg2 G A 18: 20,579,451 G171R probably damaging Het
Dusp13 C A 14: 21,743,470 G208* probably null Het
Ebf3 A C 7: 137,201,124 probably null Het
Fbn2 A T 18: 58,038,198 probably null Het
Fbxo27 A G 7: 28,693,342 D16G probably benign Het
G6pc3 A G 11: 102,193,108 S187G probably benign Het
Gucy2d G A 7: 98,472,306 V995I probably null Het
Hmcn2 C A 2: 31,354,714 P728T probably damaging Het
Il1r2 T C 1: 40,105,339 L62P probably damaging Het
Ints7 T C 1: 191,582,491 S63P probably damaging Het
Mcf2l C A 8: 12,880,089 D36E probably benign Het
Mfsd13b T G 7: 120,991,363 I109S probably benign Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Mydgf C A 17: 56,183,734 probably null Het
Nanog A T 6: 122,713,516 L268F possibly damaging Het
Olfr305 A T 7: 86,364,263 C25S probably benign Het
Olfr536 T A 7: 140,504,402 D19V probably benign Het
Otud4 T A 8: 79,659,267 N256K probably damaging Het
Pappa G A 4: 65,335,764 V1552I probably benign Het
Pax8 A T 2: 24,443,022 F103I probably damaging Het
Ptk2b T A 14: 66,174,755 S396C probably damaging Het
Rnf148 A G 6: 23,654,170 Y276H probably damaging Het
Sec11c A T 18: 65,814,840 I93L probably damaging Het
Serpinb2 T A 1: 107,523,180 N217K probably benign Het
Slc2a13 T A 15: 91,572,902 T66S probably damaging Het
Slc4a3 T C 1: 75,549,862 M9T probably benign Het
Sord G A 2: 122,256,942 V176I possibly damaging Het
Thbs4 G A 13: 92,754,284 Q892* probably null Het
Thsd7b T A 1: 129,921,420 D956E probably benign Het
Tmem251 T A 12: 102,744,172 probably null Het
Topbp1 T A 9: 103,308,977 probably null Het
Tst T C 15: 78,405,253 E194G probably damaging Het
Ttk T A 9: 83,857,327 S484T possibly damaging Het
U2surp A G 9: 95,502,554 S26P possibly damaging Het
Ugt2b37 C T 5: 87,240,855 A500T probably benign Het
Utrn A T 10: 12,670,186 Y1669* probably null Het
Vmn2r23 A T 6: 123,741,656 Q656L probably damaging Het
Wdr7 A G 18: 63,987,160 N1424S probably benign Het
Xkr9 A G 1: 13,701,379 D373G probably benign Het
Zfp984 T A 4: 147,756,211 Y61F probably benign Het
Other mutations in P2rx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:P2rx1 APN 11 73013000 critical splice donor site probably null
IGL01109:P2rx1 APN 11 73008215 missense probably damaging 0.99
IGL02466:P2rx1 APN 11 73009584 critical splice acceptor site probably null
IGL02524:P2rx1 APN 11 73009648 missense probably damaging 1.00
IGL02536:P2rx1 APN 11 73012474 missense probably damaging 1.00
PIT4382001:P2rx1 UTSW 11 73009200 missense probably benign 0.09
R0479:P2rx1 UTSW 11 73012961 missense probably damaging 1.00
R1238:P2rx1 UTSW 11 73012958 missense probably damaging 1.00
R2156:P2rx1 UTSW 11 73014113 missense probably benign 0.15
R4016:P2rx1 UTSW 11 73009973 missense probably damaging 1.00
R5345:P2rx1 UTSW 11 73009230 missense probably damaging 1.00
R5440:P2rx1 UTSW 11 73008503 missense probably benign
R6172:P2rx1 UTSW 11 73010030 missense probably damaging 0.99
R6285:P2rx1 UTSW 11 73008148 missense probably benign 0.22
R6348:P2rx1 UTSW 11 72999322 missense probably benign
R7793:P2rx1 UTSW 11 73009253 nonsense probably null
R8402:P2rx1 UTSW 11 73013889 missense probably damaging 1.00
R8723:P2rx1 UTSW 11 73008930 missense probably benign 0.05
R8857:P2rx1 UTSW 11 73012371 intron probably benign
R8903:P2rx1 UTSW 11 73009995 missense probably benign 0.03
R8965:P2rx1 UTSW 11 73009225 missense probably benign 0.00
R9007:P2rx1 UTSW 11 73009233 missense probably damaging 0.96
Z1177:P2rx1 UTSW 11 73013899 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACACTGGGACTTGTGAG -3'
(R):5'- TTCCATCTCAGGGTAGGTGACAG -3'

Sequencing Primer
(F):5'- ACTTGTGAGCTGGGCAGAG -3'
(R):5'- CAGGCAGGATGAGAGTGGC -3'
Posted On 2021-01-18