Incidental Mutation 'R8520:G6pc3'
ID 658604
Institutional Source Beutler Lab
Gene Symbol G6pc3
Ensembl Gene ENSMUSG00000034793
Gene Name glucose 6 phosphatase, catalytic, 3
Synonyms 0710001K01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8520 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 102189620-102194081 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102193108 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 187 (S187G)
Ref Sequence ENSEMBL: ENSMUSP00000077995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008999] [ENSMUST00000070334] [ENSMUST00000078975] [ENSMUST00000107150] [ENSMUST00000107151] [ENSMUST00000107152] [ENSMUST00000124077] [ENSMUST00000140962]
AlphaFold Q6NSQ9
Predicted Effect probably benign
Transcript: ENSMUST00000008999
SMART Domains Protein: ENSMUSP00000008999
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
low complexity region 58 75 N/A INTRINSIC
Pfam:HDAC4_Gln 86 174 1e-30 PFAM
low complexity region 233 247 N/A INTRINSIC
low complexity region 322 337 N/A INTRINSIC
low complexity region 502 541 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
coiled coil region 583 617 N/A INTRINSIC
Pfam:Hist_deacetyl 704 1034 1.4e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070334
AA Change: S187G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000064276
Gene: ENSMUSG00000034793
AA Change: S187G

DomainStartEndE-ValueType
acidPPc 53 187 2.53e-15 SMART
transmembrane domain 196 218 N/A INTRINSIC
transmembrane domain 284 302 N/A INTRINSIC
transmembrane domain 317 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078975
AA Change: S187G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000077995
Gene: ENSMUSG00000034793
AA Change: S187G

DomainStartEndE-ValueType
acidPPc 53 187 2.53e-15 SMART
transmembrane domain 196 218 N/A INTRINSIC
transmembrane domain 284 302 N/A INTRINSIC
transmembrane domain 317 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107150
SMART Domains Protein: ENSMUSP00000102768
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
Pfam:HDAC4_Gln 66 155 5.1e-37 PFAM
low complexity region 214 228 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 483 522 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
coiled coil region 564 598 N/A INTRINSIC
Pfam:Hist_deacetyl 685 1015 9.4e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107151
SMART Domains Protein: ENSMUSP00000102769
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:HDAC4_Gln 67 156 1.1e-37 PFAM
low complexity region 215 229 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
low complexity region 484 523 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
coiled coil region 565 599 N/A INTRINSIC
Pfam:Hist_deacetyl 618 931 1.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107152
SMART Domains Protein: ENSMUSP00000102770
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:HDAC4_Gln 67 156 3.7e-37 PFAM
low complexity region 215 229 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
low complexity region 484 523 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
coiled coil region 565 599 N/A INTRINSIC
Pfam:Hist_deacetyl 686 1016 6.4e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124077
SMART Domains Protein: ENSMUSP00000116672
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
low complexity region 37 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140962
SMART Domains Protein: ENSMUSP00000115435
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
PDB:2VQQ|B 1 71 3e-21 PDB
transmembrane domain 118 135 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of glucose-6-phosphatase (G6Pase). G6Pase is located in the endoplasmic reticulum (ER) and catalyzes the hydrolysis of glucose-6-phosphate to glucose and phosphate in the last step of the gluconeogenic and glycogenolytic pathways. Mutations in this gene result in autosomal recessive severe congenital neutropenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in females, but not males, that are growth retarded and weight less and exhibit elevated plasma glucagon levels but lowered plasma cholesterols after fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,609 F136L possibly damaging Het
A430033K04Rik T A 5: 138,646,706 N284K possibly damaging Het
Abcb1a T C 5: 8,685,346 I151T possibly damaging Het
Adam28 C T 14: 68,642,083 G172D probably damaging Het
Adcy6 A G 15: 98,604,160 V191A probably benign Het
Ankrd52 T C 10: 128,389,490 L911P probably damaging Het
C5ar1 A G 7: 16,248,151 S315P probably damaging Het
Cubn A G 2: 13,308,520 probably null Het
Dlec1 T C 9: 119,112,209 S276P probably benign Het
Dnah14 T A 1: 181,653,638 I1564N probably damaging Het
Dsg2 G A 18: 20,579,451 G171R probably damaging Het
Dusp13 C A 14: 21,743,470 G208* probably null Het
Ebf3 A C 7: 137,201,124 probably null Het
Fbn2 A T 18: 58,038,198 probably null Het
Fbxo27 A G 7: 28,693,342 D16G probably benign Het
Gucy2d G A 7: 98,472,306 V995I probably null Het
Hmcn2 C A 2: 31,354,714 P728T probably damaging Het
Il1r2 T C 1: 40,105,339 L62P probably damaging Het
Ints7 T C 1: 191,582,491 S63P probably damaging Het
Mcf2l C A 8: 12,880,089 D36E probably benign Het
Mfsd13b T G 7: 120,991,363 I109S probably benign Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Mydgf C A 17: 56,183,734 probably null Het
Nanog A T 6: 122,713,516 L268F possibly damaging Het
Olfr305 A T 7: 86,364,263 C25S probably benign Het
Olfr536 T A 7: 140,504,402 D19V probably benign Het
Otud4 T A 8: 79,659,267 N256K probably damaging Het
P2rx1 A T 11: 73,008,953 D128V probably benign Het
Pappa G A 4: 65,335,764 V1552I probably benign Het
Pax8 A T 2: 24,443,022 F103I probably damaging Het
Ptk2b T A 14: 66,174,755 S396C probably damaging Het
Rnf148 A G 6: 23,654,170 Y276H probably damaging Het
Sec11c A T 18: 65,814,840 I93L probably damaging Het
Serpinb2 T A 1: 107,523,180 N217K probably benign Het
Slc2a13 T A 15: 91,572,902 T66S probably damaging Het
Slc4a3 T C 1: 75,549,862 M9T probably benign Het
Sord G A 2: 122,256,942 V176I possibly damaging Het
Thbs4 G A 13: 92,754,284 Q892* probably null Het
Thsd7b T A 1: 129,921,420 D956E probably benign Het
Tmem251 T A 12: 102,744,172 probably null Het
Topbp1 T A 9: 103,308,977 probably null Het
Tst T C 15: 78,405,253 E194G probably damaging Het
Ttk T A 9: 83,857,327 S484T possibly damaging Het
U2surp A G 9: 95,502,554 S26P possibly damaging Het
Ugt2b37 C T 5: 87,240,855 A500T probably benign Het
Utrn A T 10: 12,670,186 Y1669* probably null Het
Vmn2r23 A T 6: 123,741,656 Q656L probably damaging Het
Wdr7 A G 18: 63,987,160 N1424S probably benign Het
Xkr9 A G 1: 13,701,379 D373G probably benign Het
Zfp984 T A 4: 147,756,211 Y61F probably benign Het
Other mutations in G6pc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:G6pc3 APN 11 102193105 missense probably benign 0.01
PIT4378001:G6pc3 UTSW 11 102190001 missense probably damaging 1.00
R1121:G6pc3 UTSW 11 102189942 missense possibly damaging 0.49
R4844:G6pc3 UTSW 11 102193231 splice site probably null
R6736:G6pc3 UTSW 11 102193670 missense possibly damaging 0.62
R8871:G6pc3 UTSW 11 102192070 missense probably damaging 1.00
R9105:G6pc3 UTSW 11 102193577 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACTTCTCAGCAGTCCCAGC -3'
(R):5'- TGCGCCCATGTGTTATGACC -3'

Sequencing Primer
(F):5'- CGTCTGTAGAGCCAACCTTAAGG -3'
(R):5'- TGAAATCCACTACCTAGGTACAAGTG -3'
Posted On 2021-01-18