Incidental Mutation 'R8520:Thbs4'
ID 658606
Institutional Source Beutler Lab
Gene Symbol Thbs4
Ensembl Gene ENSMUSG00000021702
Gene Name thrombospondin 4
Synonyms TSP4, TSP-4
MMRRC Submission 067947-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8520 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 92888098-92931326 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 92890792 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 892 (Q892*)
Ref Sequence ENSEMBL: ENSMUSP00000022213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022213]
AlphaFold Q9Z1T2
Predicted Effect probably null
Transcript: ENSMUST00000022213
AA Change: Q892*
SMART Domains Protein: ENSMUSP00000022213
Gene: ENSMUSG00000021702
AA Change: Q892*

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
TSPN 26 194 1.66e-51 SMART
Pfam:COMP 220 264 1.2e-24 PFAM
low complexity region 280 290 N/A INTRINSIC
EGF 291 327 1.04e-3 SMART
EGF_CA 328 380 7.29e-8 SMART
EGF_CA 381 421 1.42e-10 SMART
EGF 425 464 4.32e-1 SMART
Pfam:TSP_3 498 533 7.1e-15 PFAM
Pfam:TSP_3 557 592 7.8e-17 PFAM
Pfam:TSP_3 616 653 1.4e-11 PFAM
Pfam:TSP_3 654 693 1.3e-10 PFAM
Pfam:TSP_3 694 729 1e-14 PFAM
Pfam:TSP_C 747 944 3.8e-102 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to cardiac pressure overload, including increased hypertrophy, decreased ejection fraction, decreased microvessle number, increased extracellular matrix deposition and increased fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,838,423 (GRCm39) F136L possibly damaging Het
A430033K04Rik T A 5: 138,644,968 (GRCm39) N284K possibly damaging Het
Abcb1a T C 5: 8,735,346 (GRCm39) I151T possibly damaging Het
Adam28 C T 14: 68,879,532 (GRCm39) G172D probably damaging Het
Adcy6 A G 15: 98,502,041 (GRCm39) V191A probably benign Het
Ankrd52 T C 10: 128,225,359 (GRCm39) L911P probably damaging Het
C5ar1 A G 7: 15,982,076 (GRCm39) S315P probably damaging Het
Cubn A G 2: 13,313,331 (GRCm39) probably null Het
Dlec1 T C 9: 118,941,277 (GRCm39) S276P probably benign Het
Dnah14 T A 1: 181,481,203 (GRCm39) I1564N probably damaging Het
Dsg2 G A 18: 20,712,508 (GRCm39) G171R probably damaging Het
Dusp13b C A 14: 21,793,538 (GRCm39) G208* probably null Het
Ebf3 A C 7: 136,802,853 (GRCm39) probably null Het
Fbn2 A T 18: 58,171,270 (GRCm39) probably null Het
Fbxo27 A G 7: 28,392,767 (GRCm39) D16G probably benign Het
G6pc3 A G 11: 102,083,934 (GRCm39) S187G probably benign Het
Gucy2d G A 7: 98,121,513 (GRCm39) V995I probably null Het
Hmcn2 C A 2: 31,244,726 (GRCm39) P728T probably damaging Het
Il1r2 T C 1: 40,144,499 (GRCm39) L62P probably damaging Het
Ints7 T C 1: 191,314,603 (GRCm39) S63P probably damaging Het
Lyset T A 12: 102,710,431 (GRCm39) probably null Het
Mcf2l C A 8: 12,930,089 (GRCm39) D36E probably benign Het
Mfsd13b T G 7: 120,590,586 (GRCm39) I109S probably benign Het
Mier2 G A 10: 79,378,263 (GRCm39) H385Y possibly damaging Het
Mydgf C A 17: 56,490,734 (GRCm39) probably null Het
Nanog A T 6: 122,690,475 (GRCm39) L268F possibly damaging Het
Or12j5 T A 7: 140,084,315 (GRCm39) D19V probably benign Het
Or14a259 A T 7: 86,013,471 (GRCm39) C25S probably benign Het
Otud4 T A 8: 80,385,896 (GRCm39) N256K probably damaging Het
P2rx1 A T 11: 72,899,779 (GRCm39) D128V probably benign Het
Pappa G A 4: 65,254,001 (GRCm39) V1552I probably benign Het
Pax8 A T 2: 24,333,034 (GRCm39) F103I probably damaging Het
Ptk2b T A 14: 66,412,204 (GRCm39) S396C probably damaging Het
Rnf148 A G 6: 23,654,169 (GRCm39) Y276H probably damaging Het
Sec11c A T 18: 65,947,911 (GRCm39) I93L probably damaging Het
Serpinb2 T A 1: 107,450,910 (GRCm39) N217K probably benign Het
Slc2a13 T A 15: 91,457,105 (GRCm39) T66S probably damaging Het
Slc4a3 T C 1: 75,526,506 (GRCm39) M9T probably benign Het
Sord G A 2: 122,087,423 (GRCm39) V176I possibly damaging Het
Thsd7b T A 1: 129,849,157 (GRCm39) D956E probably benign Het
Topbp1 T A 9: 103,186,176 (GRCm39) probably null Het
Tst T C 15: 78,289,453 (GRCm39) E194G probably damaging Het
Ttk T A 9: 83,739,380 (GRCm39) S484T possibly damaging Het
U2surp A G 9: 95,384,607 (GRCm39) S26P possibly damaging Het
Ugt2b37 C T 5: 87,388,714 (GRCm39) A500T probably benign Het
Utrn A T 10: 12,545,930 (GRCm39) Y1669* probably null Het
Vmn2r23 A T 6: 123,718,615 (GRCm39) Q656L probably damaging Het
Wdr7 A G 18: 64,120,231 (GRCm39) N1424S probably benign Het
Xkr9 A G 1: 13,771,603 (GRCm39) D373G probably benign Het
Zfp984 T A 4: 147,840,668 (GRCm39) Y61F probably benign Het
Other mutations in Thbs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Thbs4 APN 13 92,913,488 (GRCm39) missense probably benign 0.04
IGL02318:Thbs4 APN 13 92,900,092 (GRCm39) missense probably damaging 1.00
IGL02887:Thbs4 APN 13 92,927,306 (GRCm39) missense probably benign 0.00
IGL03205:Thbs4 APN 13 92,899,282 (GRCm39) missense probably damaging 1.00
IGL03382:Thbs4 APN 13 92,906,056 (GRCm39) missense probably benign 0.37
R0087:Thbs4 UTSW 13 92,891,743 (GRCm39) missense probably damaging 0.99
R0128:Thbs4 UTSW 13 92,890,918 (GRCm39) missense probably benign 0.00
R0130:Thbs4 UTSW 13 92,890,918 (GRCm39) missense probably benign 0.00
R0276:Thbs4 UTSW 13 92,912,040 (GRCm39) missense probably benign 0.00
R0423:Thbs4 UTSW 13 92,893,079 (GRCm39) missense probably damaging 0.99
R0504:Thbs4 UTSW 13 92,903,692 (GRCm39) missense probably benign 0.04
R0708:Thbs4 UTSW 13 92,909,694 (GRCm39) missense probably damaging 1.00
R0836:Thbs4 UTSW 13 92,894,546 (GRCm39) missense probably damaging 1.00
R1078:Thbs4 UTSW 13 92,899,434 (GRCm39) splice site probably benign
R1139:Thbs4 UTSW 13 92,911,226 (GRCm39) missense probably damaging 1.00
R1253:Thbs4 UTSW 13 92,913,413 (GRCm39) missense probably benign 0.17
R1342:Thbs4 UTSW 13 92,888,925 (GRCm39) missense probably damaging 1.00
R1416:Thbs4 UTSW 13 92,898,041 (GRCm39) missense probably benign
R1834:Thbs4 UTSW 13 92,897,989 (GRCm39) missense probably benign 0.00
R1950:Thbs4 UTSW 13 92,906,079 (GRCm39) missense probably damaging 0.99
R2056:Thbs4 UTSW 13 92,927,387 (GRCm39) missense probably benign 0.00
R2184:Thbs4 UTSW 13 92,911,302 (GRCm39) missense probably benign
R2198:Thbs4 UTSW 13 92,899,779 (GRCm39) missense possibly damaging 0.78
R2859:Thbs4 UTSW 13 92,927,216 (GRCm39) missense probably benign 0.02
R3605:Thbs4 UTSW 13 92,894,467 (GRCm39) nonsense probably null
R3783:Thbs4 UTSW 13 92,909,672 (GRCm39) missense probably benign 0.09
R3784:Thbs4 UTSW 13 92,909,672 (GRCm39) missense probably benign 0.09
R3786:Thbs4 UTSW 13 92,909,672 (GRCm39) missense probably benign 0.09
R3787:Thbs4 UTSW 13 92,909,672 (GRCm39) missense probably benign 0.09
R4061:Thbs4 UTSW 13 92,912,605 (GRCm39) critical splice donor site probably null
R4790:Thbs4 UTSW 13 92,899,314 (GRCm39) missense probably damaging 1.00
R4968:Thbs4 UTSW 13 92,894,576 (GRCm39) missense possibly damaging 0.55
R4983:Thbs4 UTSW 13 92,927,207 (GRCm39) missense probably benign 0.29
R5185:Thbs4 UTSW 13 92,911,675 (GRCm39) missense probably damaging 0.97
R5352:Thbs4 UTSW 13 92,900,098 (GRCm39) missense probably damaging 1.00
R5361:Thbs4 UTSW 13 92,913,501 (GRCm39) missense probably benign
R5589:Thbs4 UTSW 13 92,912,582 (GRCm39) splice site probably null
R5700:Thbs4 UTSW 13 92,913,461 (GRCm39) missense probably benign 0.00
R6061:Thbs4 UTSW 13 92,888,303 (GRCm39) missense probably benign 0.00
R6101:Thbs4 UTSW 13 92,911,993 (GRCm39) missense possibly damaging 0.90
R6105:Thbs4 UTSW 13 92,911,993 (GRCm39) missense possibly damaging 0.90
R6227:Thbs4 UTSW 13 92,911,190 (GRCm39) missense probably null 1.00
R6249:Thbs4 UTSW 13 92,911,215 (GRCm39) missense probably damaging 1.00
R6651:Thbs4 UTSW 13 92,893,044 (GRCm39) missense probably benign 0.06
R6735:Thbs4 UTSW 13 92,891,674 (GRCm39) missense possibly damaging 0.71
R6885:Thbs4 UTSW 13 92,899,377 (GRCm39) missense probably damaging 0.96
R6913:Thbs4 UTSW 13 92,894,444 (GRCm39) missense possibly damaging 0.94
R7409:Thbs4 UTSW 13 92,909,767 (GRCm39) nonsense probably null
R7480:Thbs4 UTSW 13 92,903,729 (GRCm39) missense probably benign 0.00
R7682:Thbs4 UTSW 13 92,912,070 (GRCm39) missense probably benign 0.21
R8022:Thbs4 UTSW 13 92,888,955 (GRCm39) missense probably damaging 1.00
R8213:Thbs4 UTSW 13 92,897,094 (GRCm39) critical splice acceptor site probably null
R8231:Thbs4 UTSW 13 92,911,352 (GRCm39) missense probably benign
R8353:Thbs4 UTSW 13 92,927,325 (GRCm39) missense probably benign 0.04
R8445:Thbs4 UTSW 13 92,927,349 (GRCm39) missense probably benign 0.00
R8453:Thbs4 UTSW 13 92,927,325 (GRCm39) missense probably benign 0.04
R8560:Thbs4 UTSW 13 92,891,608 (GRCm39) missense probably damaging 0.97
R8774:Thbs4 UTSW 13 92,898,030 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Thbs4 UTSW 13 92,898,030 (GRCm39) missense probably damaging 1.00
R9061:Thbs4 UTSW 13 92,911,187 (GRCm39) critical splice donor site probably null
R9223:Thbs4 UTSW 13 92,897,998 (GRCm39) missense probably damaging 1.00
R9653:Thbs4 UTSW 13 92,898,022 (GRCm39) missense probably benign
R9691:Thbs4 UTSW 13 92,890,896 (GRCm39) missense probably damaging 1.00
R9778:Thbs4 UTSW 13 92,913,495 (GRCm39) missense probably benign 0.17
Z1177:Thbs4 UTSW 13 92,890,884 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGTGTGGACTAGGTTCC -3'
(R):5'- GACCTAACATTTTGCCCATGTC -3'

Sequencing Primer
(F):5'- ACTAGGTTCCATGGGGCCTG -3'
(R):5'- CTTTGTCCAGGCTGTGAAGTC -3'
Posted On 2021-01-18