Mutagenetix > Incidental Mutation

Incidental Mutation 'R8520:Thbs4'

658606

Institutional Source

Beutler Lab

Gene Symbol

Thbs4

Ensembl Gene

ENSMUSG00000021702

Gene Name

thrombospondin 4

Synonyms

TSP-4, TSP4

MMRRC Submission

067947-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8520 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92751590-92794818 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 92754284 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 892 (Q892*)

Ref Sequence

ENSEMBL: ENSMUSP00000022213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022213]

AlphaFold

Q9Z1T2

Predicted Effect

probably null
Transcript: ENSMUST00000022213
AA Change: Q892*

SMART Domains

Protein: ENSMUSP00000022213
Gene: ENSMUSG00000021702
AA Change: Q892*

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
TSPN	26	194	1.66e-51	SMART
Pfam:COMP	220	264	1.2e-24	PFAM
low complexity region	280	290	N/A	INTRINSIC
EGF	291	327	1.04e-3	SMART
EGF_CA	328	380	7.29e-8	SMART
EGF_CA	381	421	1.42e-10	SMART
EGF	425	464	4.32e-1	SMART
Pfam:TSP_3	498	533	7.1e-15	PFAM
Pfam:TSP_3	557	592	7.8e-17	PFAM
Pfam:TSP_3	616	653	1.4e-11	PFAM
Pfam:TSP_3	654	693	1.3e-10	PFAM
Pfam:TSP_3	694	729	1e-14	PFAM
Pfam:TSP_C	747	944	3.8e-102	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to cardiac pressure overload, including increased hypertrophy, decreased ejection fraction, decreased microvessle number, increased extracellular matrix deposition and increased fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	T	13: 59,690,609	F136L	possibly damaging	Het
A430033K04Rik	T	A	5: 138,646,706	N284K	possibly damaging	Het
Abcb1a	T	C	5: 8,685,346	I151T	possibly damaging	Het
Adam28	C	T	14: 68,642,083	G172D	probably damaging	Het
Adcy6	A	G	15: 98,604,160	V191A	probably benign	Het
Ankrd52	T	C	10: 128,389,490	L911P	probably damaging	Het
C5ar1	A	G	7: 16,248,151	S315P	probably damaging	Het
Cubn	A	G	2: 13,308,520		probably null	Het
Dlec1	T	C	9: 119,112,209	S276P	probably benign	Het
Dnah14	T	A	1: 181,653,638	I1564N	probably damaging	Het
Dsg2	G	A	18: 20,579,451	G171R	probably damaging	Het
Dusp13	C	A	14: 21,743,470	G208*	probably null	Het
Ebf3	A	C	7: 137,201,124		probably null	Het
Fbn2	A	T	18: 58,038,198		probably null	Het
Fbxo27	A	G	7: 28,693,342	D16G	probably benign	Het
G6pc3	A	G	11: 102,193,108	S187G	probably benign	Het
Gucy2d	G	A	7: 98,472,306	V995I	probably null	Het
Hmcn2	C	A	2: 31,354,714	P728T	probably damaging	Het
Il1r2	T	C	1: 40,105,339	L62P	probably damaging	Het
Ints7	T	C	1: 191,582,491	S63P	probably damaging	Het
Mcf2l	C	A	8: 12,880,089	D36E	probably benign	Het
Mfsd13b	T	G	7: 120,991,363	I109S	probably benign	Het
Mier2	G	A	10: 79,542,429	H385Y	possibly damaging	Het
Mydgf	C	A	17: 56,183,734		probably null	Het
Nanog	A	T	6: 122,713,516	L268F	possibly damaging	Het
Olfr305	A	T	7: 86,364,263	C25S	probably benign	Het
Olfr536	T	A	7: 140,504,402	D19V	probably benign	Het
Otud4	T	A	8: 79,659,267	N256K	probably damaging	Het
P2rx1	A	T	11: 73,008,953	D128V	probably benign	Het
Pappa	G	A	4: 65,335,764	V1552I	probably benign	Het
Pax8	A	T	2: 24,443,022	F103I	probably damaging	Het
Ptk2b	T	A	14: 66,174,755	S396C	probably damaging	Het
Rnf148	A	G	6: 23,654,170	Y276H	probably damaging	Het
Sec11c	A	T	18: 65,814,840	I93L	probably damaging	Het
Serpinb2	T	A	1: 107,523,180	N217K	probably benign	Het
Slc2a13	T	A	15: 91,572,902	T66S	probably damaging	Het
Slc4a3	T	C	1: 75,549,862	M9T	probably benign	Het
Sord	G	A	2: 122,256,942	V176I	possibly damaging	Het
Thsd7b	T	A	1: 129,921,420	D956E	probably benign	Het
Tmem251	T	A	12: 102,744,172		probably null	Het
Topbp1	T	A	9: 103,308,977		probably null	Het
Tst	T	C	15: 78,405,253	E194G	probably damaging	Het
Ttk	T	A	9: 83,857,327	S484T	possibly damaging	Het
U2surp	A	G	9: 95,502,554	S26P	possibly damaging	Het
Ugt2b37	C	T	5: 87,240,855	A500T	probably benign	Het
Utrn	A	T	10: 12,670,186	Y1669*	probably null	Het
Vmn2r23	A	T	6: 123,741,656	Q656L	probably damaging	Het
Wdr7	A	G	18: 63,987,160	N1424S	probably benign	Het
Xkr9	A	G	1: 13,701,379	D373G	probably benign	Het
Zfp984	T	A	4: 147,756,211	Y61F	probably benign	Het

Other mutations in Thbs4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Thbs4	APN	13	92776980	missense	probably benign	0.04
IGL02318:Thbs4	APN	13	92763584	missense	probably damaging	1.00
IGL02887:Thbs4	APN	13	92790798	missense	probably benign	0.00
IGL03205:Thbs4	APN	13	92762774	missense	probably damaging	1.00
IGL03382:Thbs4	APN	13	92769548	missense	probably benign	0.37
R0087:Thbs4	UTSW	13	92755235	missense	probably damaging	0.99
R0128:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0130:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0276:Thbs4	UTSW	13	92775532	missense	probably benign	0.00
R0423:Thbs4	UTSW	13	92756571	missense	probably damaging	0.99
R0504:Thbs4	UTSW	13	92767184	missense	probably benign	0.04
R0708:Thbs4	UTSW	13	92773186	missense	probably damaging	1.00
R0836:Thbs4	UTSW	13	92758038	missense	probably damaging	1.00
R1078:Thbs4	UTSW	13	92762926	splice site	probably benign
R1139:Thbs4	UTSW	13	92774718	missense	probably damaging	1.00
R1253:Thbs4	UTSW	13	92776905	missense	probably benign	0.17
R1342:Thbs4	UTSW	13	92752417	missense	probably damaging	1.00
R1416:Thbs4	UTSW	13	92761533	missense	probably benign
R1834:Thbs4	UTSW	13	92761481	missense	probably benign	0.00
R1950:Thbs4	UTSW	13	92769571	missense	probably damaging	0.99
R2056:Thbs4	UTSW	13	92790879	missense	probably benign	0.00
R2184:Thbs4	UTSW	13	92774794	missense	probably benign
R2198:Thbs4	UTSW	13	92763271	missense	possibly damaging	0.78
R2859:Thbs4	UTSW	13	92790708	missense	probably benign	0.02
R3605:Thbs4	UTSW	13	92757959	nonsense	probably null
R3783:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3784:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3786:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3787:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R4061:Thbs4	UTSW	13	92776097	critical splice donor site	probably null
R4790:Thbs4	UTSW	13	92762806	missense	probably damaging	1.00
R4968:Thbs4	UTSW	13	92758068	missense	possibly damaging	0.55
R4983:Thbs4	UTSW	13	92790699	missense	probably benign	0.29
R5185:Thbs4	UTSW	13	92775167	missense	probably damaging	0.97
R5352:Thbs4	UTSW	13	92763590	missense	probably damaging	1.00
R5361:Thbs4	UTSW	13	92776993	missense	probably benign
R5589:Thbs4	UTSW	13	92776074	splice site	probably null
R5700:Thbs4	UTSW	13	92776953	missense	probably benign	0.00
R6061:Thbs4	UTSW	13	92751795	missense	probably benign	0.00
R6101:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6105:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6227:Thbs4	UTSW	13	92774682	missense	probably null	1.00
R6249:Thbs4	UTSW	13	92774707	missense	probably damaging	1.00
R6651:Thbs4	UTSW	13	92756536	missense	probably benign	0.06
R6735:Thbs4	UTSW	13	92755166	missense	possibly damaging	0.71
R6885:Thbs4	UTSW	13	92762869	missense	probably damaging	0.96
R6913:Thbs4	UTSW	13	92757936	missense	possibly damaging	0.94
R7409:Thbs4	UTSW	13	92773259	nonsense	probably null
R7480:Thbs4	UTSW	13	92767221	missense	probably benign	0.00
R7682:Thbs4	UTSW	13	92775562	missense	probably benign	0.21
R8022:Thbs4	UTSW	13	92752447	missense	probably damaging	1.00
R8213:Thbs4	UTSW	13	92760586	critical splice acceptor site	probably null
R8231:Thbs4	UTSW	13	92774844	missense	probably benign
R8353:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8445:Thbs4	UTSW	13	92790841	missense	probably benign	0.00
R8453:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8560:Thbs4	UTSW	13	92755100	missense	probably damaging	0.97
R8774:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R8774-TAIL:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R9061:Thbs4	UTSW	13	92774679	critical splice donor site	probably null
R9223:Thbs4	UTSW	13	92761490	missense	probably damaging	1.00
R9653:Thbs4	UTSW	13	92761514	missense	probably benign
R9691:Thbs4	UTSW	13	92754388	missense	probably damaging	1.00
R9778:Thbs4	UTSW	13	92776987	missense	probably benign	0.17
Z1177:Thbs4	UTSW	13	92754376	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCAGTGTGGACTAGGTTCC -3'
(R):5'- GACCTAACATTTTGCCCATGTC -3'

Sequencing Primer
(F):5'- ACTAGGTTCCATGGGGCCTG -3'
(R):5'- CTTTGTCCAGGCTGTGAAGTC -3'

Posted On

2021-01-18