Incidental Mutation 'R8520:Slc2a13'
ID 658610
Institutional Source Beutler Lab
Gene Symbol Slc2a13
Ensembl Gene ENSMUSG00000036298
Gene Name solute carrier family 2 (facilitated glucose transporter), member 13
Synonyms A630029G22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8520 (G1)
Quality Score 107.008
Status Validated
Chromosome 15
Chromosomal Location 91267696-91573261 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 91572902 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 66 (T66S)
Ref Sequence ENSEMBL: ENSMUSP00000104906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109283]
AlphaFold Q3UHK1
Predicted Effect probably damaging
Transcript: ENSMUST00000109283
AA Change: T66S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104906
Gene: ENSMUSG00000036298
AA Change: T66S

DomainStartEndE-ValueType
low complexity region 36 54 N/A INTRINSIC
Pfam:Sugar_tr 73 412 2e-87 PFAM
Pfam:MFS_1 77 411 6.6e-23 PFAM
Pfam:Sugar_tr 487 598 8.1e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,609 F136L possibly damaging Het
A430033K04Rik T A 5: 138,646,706 N284K possibly damaging Het
Abcb1a T C 5: 8,685,346 I151T possibly damaging Het
Adam28 C T 14: 68,642,083 G172D probably damaging Het
Adcy6 A G 15: 98,604,160 V191A probably benign Het
Ankrd52 T C 10: 128,389,490 L911P probably damaging Het
C5ar1 A G 7: 16,248,151 S315P probably damaging Het
Cubn A G 2: 13,308,520 probably null Het
Dlec1 T C 9: 119,112,209 S276P probably benign Het
Dnah14 T A 1: 181,653,638 I1564N probably damaging Het
Dsg2 G A 18: 20,579,451 G171R probably damaging Het
Dusp13 C A 14: 21,743,470 G208* probably null Het
Ebf3 A C 7: 137,201,124 probably null Het
Fbn2 A T 18: 58,038,198 probably null Het
Fbxo27 A G 7: 28,693,342 D16G probably benign Het
G6pc3 A G 11: 102,193,108 S187G probably benign Het
Gucy2d G A 7: 98,472,306 V995I probably null Het
Hmcn2 C A 2: 31,354,714 P728T probably damaging Het
Il1r2 T C 1: 40,105,339 L62P probably damaging Het
Ints7 T C 1: 191,582,491 S63P probably damaging Het
Mcf2l C A 8: 12,880,089 D36E probably benign Het
Mfsd13b T G 7: 120,991,363 I109S probably benign Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Mydgf C A 17: 56,183,734 probably null Het
Nanog A T 6: 122,713,516 L268F possibly damaging Het
Olfr305 A T 7: 86,364,263 C25S probably benign Het
Olfr536 T A 7: 140,504,402 D19V probably benign Het
Otud4 T A 8: 79,659,267 N256K probably damaging Het
P2rx1 A T 11: 73,008,953 D128V probably benign Het
Pappa G A 4: 65,335,764 V1552I probably benign Het
Pax8 A T 2: 24,443,022 F103I probably damaging Het
Ptk2b T A 14: 66,174,755 S396C probably damaging Het
Rnf148 A G 6: 23,654,170 Y276H probably damaging Het
Sec11c A T 18: 65,814,840 I93L probably damaging Het
Serpinb2 T A 1: 107,523,180 N217K probably benign Het
Slc4a3 T C 1: 75,549,862 M9T probably benign Het
Sord G A 2: 122,256,942 V176I possibly damaging Het
Thbs4 G A 13: 92,754,284 Q892* probably null Het
Thsd7b T A 1: 129,921,420 D956E probably benign Het
Tmem251 T A 12: 102,744,172 probably null Het
Topbp1 T A 9: 103,308,977 probably null Het
Tst T C 15: 78,405,253 E194G probably damaging Het
Ttk T A 9: 83,857,327 S484T possibly damaging Het
U2surp A G 9: 95,502,554 S26P possibly damaging Het
Ugt2b37 C T 5: 87,240,855 A500T probably benign Het
Utrn A T 10: 12,670,186 Y1669* probably null Het
Vmn2r23 A T 6: 123,741,656 Q656L probably damaging Het
Wdr7 A G 18: 63,987,160 N1424S probably benign Het
Xkr9 A G 1: 13,701,379 D373G probably benign Het
Zfp984 T A 4: 147,756,211 Y61F probably benign Het
Other mutations in Slc2a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Slc2a13 APN 15 91497399 missense probably benign
IGL01295:Slc2a13 APN 15 91350132 critical splice acceptor site probably null
IGL01863:Slc2a13 APN 15 91516492 missense probably benign 0.00
IGL02149:Slc2a13 APN 15 91343721 missense probably benign
IGL02670:Slc2a13 APN 15 91497509 missense probably damaging 0.99
IGL02692:Slc2a13 APN 15 91321658 missense probably benign 0.23
IGL03307:Slc2a13 APN 15 91276114 missense probably damaging 0.98
R0394:Slc2a13 UTSW 15 91516392 missense probably damaging 1.00
R0624:Slc2a13 UTSW 15 91350012 missense possibly damaging 0.89
R0698:Slc2a13 UTSW 15 91321667 missense probably benign
R0702:Slc2a13 UTSW 15 91321667 missense probably benign
R1052:Slc2a13 UTSW 15 91412160 missense probably damaging 0.96
R2090:Slc2a13 UTSW 15 91516492 missense probably benign 0.00
R2118:Slc2a13 UTSW 15 91516476 missense probably damaging 0.99
R4445:Slc2a13 UTSW 15 91350020 missense possibly damaging 0.46
R4896:Slc2a13 UTSW 15 91412212 missense probably benign 0.20
R6028:Slc2a13 UTSW 15 91276116 missense probably damaging 1.00
R6414:Slc2a13 UTSW 15 91343805 missense probably benign 0.00
R6836:Slc2a13 UTSW 15 91321632 missense probably benign 0.00
R6928:Slc2a13 UTSW 15 91276179 missense probably damaging 1.00
R7353:Slc2a13 UTSW 15 91321604 missense probably benign
R7423:Slc2a13 UTSW 15 91572680 missense probably damaging 1.00
R7458:Slc2a13 UTSW 15 91412187 missense probably benign 0.04
R7641:Slc2a13 UTSW 15 91272156 makesense probably null
R7993:Slc2a13 UTSW 15 91412153 nonsense probably null
R8057:Slc2a13 UTSW 15 91516416 missense probably damaging 0.99
R8164:Slc2a13 UTSW 15 91276078 missense probably damaging 0.96
R8794:Slc2a13 UTSW 15 91350099 missense probably damaging 1.00
R9061:Slc2a13 UTSW 15 91350130 missense possibly damaging 0.85
R9185:Slc2a13 UTSW 15 91343703 missense probably damaging 0.99
R9396:Slc2a13 UTSW 15 91343712 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAGCGTCTCCTTGTTGG -3'
(R):5'- GGAGGAGTTCTTCTCTGTCTCC -3'

Sequencing Primer
(F):5'- CCAGCAGGATGGCGCTG -3'
(R):5'- TCCAAGCGGGCAAGTGAC -3'
Posted On 2021-01-18