Incidental Mutation 'R8520:Dsg2'
ID 658612
Institutional Source Beutler Lab
Gene Symbol Dsg2
Ensembl Gene ENSMUSG00000044393
Gene Name desmoglein 2
Synonyms D18Ertd293e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock # R8520 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 20558074-20604521 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 20579451 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 171 (G171R)
Ref Sequence ENSEMBL: ENSMUSP00000113029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059787] [ENSMUST00000120102] [ENSMUST00000121837]
AlphaFold O55111
Predicted Effect probably damaging
Transcript: ENSMUST00000059787
AA Change: G171R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057096
Gene: ENSMUSG00000044393
AA Change: G171R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 75 162 2.39e-8 SMART
CA 186 275 5.17e-27 SMART
CA 298 392 1.94e-8 SMART
CA 418 502 2.34e-16 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 822 838 N/A INTRINSIC
low complexity region 914 928 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120102
AA Change: G171R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113153
Gene: ENSMUSG00000044393
AA Change: G171R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 75 162 2.39e-8 SMART
CA 186 275 5.17e-27 SMART
Pfam:Cadherin 282 347 6.9e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121837
AA Change: G171R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113029
Gene: ENSMUSG00000044393
AA Change: G171R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 75 162 2.39e-8 SMART
CA 186 275 5.17e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein die in utero. Mutant mice lacking a part of the extracellular adhesive domain of the encoded protein develop cardiac fibrosis and dilation. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before somite formation, impaired cell proliferation, and increased apoptosis. Heterozygous mutation of this gene also results in embryonic lethality before somite formation with partial penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,609 F136L possibly damaging Het
A430033K04Rik T A 5: 138,646,706 N284K possibly damaging Het
Abcb1a T C 5: 8,685,346 I151T possibly damaging Het
Adam28 C T 14: 68,642,083 G172D probably damaging Het
Adcy6 A G 15: 98,604,160 V191A probably benign Het
Ankrd52 T C 10: 128,389,490 L911P probably damaging Het
C5ar1 A G 7: 16,248,151 S315P probably damaging Het
Cubn A G 2: 13,308,520 probably null Het
Dlec1 T C 9: 119,112,209 S276P probably benign Het
Dnah14 T A 1: 181,653,638 I1564N probably damaging Het
Dusp13 C A 14: 21,743,470 G208* probably null Het
Ebf3 A C 7: 137,201,124 probably null Het
Fbn2 A T 18: 58,038,198 probably null Het
Fbxo27 A G 7: 28,693,342 D16G probably benign Het
G6pc3 A G 11: 102,193,108 S187G probably benign Het
Gucy2d G A 7: 98,472,306 V995I probably null Het
Hmcn2 C A 2: 31,354,714 P728T probably damaging Het
Il1r2 T C 1: 40,105,339 L62P probably damaging Het
Ints7 T C 1: 191,582,491 S63P probably damaging Het
Mcf2l C A 8: 12,880,089 D36E probably benign Het
Mfsd13b T G 7: 120,991,363 I109S probably benign Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Mydgf C A 17: 56,183,734 probably null Het
Nanog A T 6: 122,713,516 L268F possibly damaging Het
Olfr305 A T 7: 86,364,263 C25S probably benign Het
Olfr536 T A 7: 140,504,402 D19V probably benign Het
Otud4 T A 8: 79,659,267 N256K probably damaging Het
P2rx1 A T 11: 73,008,953 D128V probably benign Het
Pappa G A 4: 65,335,764 V1552I probably benign Het
Pax8 A T 2: 24,443,022 F103I probably damaging Het
Ptk2b T A 14: 66,174,755 S396C probably damaging Het
Rnf148 A G 6: 23,654,170 Y276H probably damaging Het
Sec11c A T 18: 65,814,840 I93L probably damaging Het
Serpinb2 T A 1: 107,523,180 N217K probably benign Het
Slc2a13 T A 15: 91,572,902 T66S probably damaging Het
Slc4a3 T C 1: 75,549,862 M9T probably benign Het
Sord G A 2: 122,256,942 V176I possibly damaging Het
Thbs4 G A 13: 92,754,284 Q892* probably null Het
Thsd7b T A 1: 129,921,420 D956E probably benign Het
Tmem251 T A 12: 102,744,172 probably null Het
Topbp1 T A 9: 103,308,977 probably null Het
Tst T C 15: 78,405,253 E194G probably damaging Het
Ttk T A 9: 83,857,327 S484T possibly damaging Het
U2surp A G 9: 95,502,554 S26P possibly damaging Het
Ugt2b37 C T 5: 87,240,855 A500T probably benign Het
Utrn A T 10: 12,670,186 Y1669* probably null Het
Vmn2r23 A T 6: 123,741,656 Q656L probably damaging Het
Wdr7 A G 18: 63,987,160 N1424S probably benign Het
Xkr9 A G 1: 13,701,379 D373G probably benign Het
Zfp984 T A 4: 147,756,211 Y61F probably benign Het
Other mutations in Dsg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dsg2 APN 18 20601769 missense probably benign 0.10
IGL00979:Dsg2 APN 18 20582767 missense probably damaging 0.99
IGL01081:Dsg2 APN 18 20589942 unclassified probably benign
IGL01358:Dsg2 APN 18 20601793 missense probably damaging 0.98
IGL02002:Dsg2 APN 18 20579176 missense probably damaging 1.00
IGL02263:Dsg2 APN 18 20590020 missense possibly damaging 0.70
IGL02410:Dsg2 APN 18 20602132 missense probably benign 0.04
IGL02553:Dsg2 APN 18 20592410 missense probably damaging 1.00
IGL03036:Dsg2 APN 18 20579077 missense probably damaging 0.99
dissolute UTSW 18 20595951 splice site probably null
Dysjunction UTSW 18 20582939 nonsense probably null
weg UTSW 18 20580651 nonsense probably null
R0094:Dsg2 UTSW 18 20591853 missense probably benign 0.08
R0094:Dsg2 UTSW 18 20591853 missense probably benign 0.08
R0105:Dsg2 UTSW 18 20602054 missense probably benign 0.03
R0105:Dsg2 UTSW 18 20602054 missense probably benign 0.03
R0112:Dsg2 UTSW 18 20583042 missense probably benign 0.02
R0305:Dsg2 UTSW 18 20582695 splice site probably benign
R0380:Dsg2 UTSW 18 20582939 nonsense probably null
R0401:Dsg2 UTSW 18 20592508 splice site probably benign
R0421:Dsg2 UTSW 18 20579391 missense probably damaging 1.00
R0578:Dsg2 UTSW 18 20594234 missense probably benign 0.00
R0667:Dsg2 UTSW 18 20573499 missense possibly damaging 0.50
R1223:Dsg2 UTSW 18 20573493 missense probably benign 0.23
R1433:Dsg2 UTSW 18 20582723 missense probably damaging 0.98
R1543:Dsg2 UTSW 18 20594211 missense probably benign 0.33
R1730:Dsg2 UTSW 18 20591880 missense probably benign 0.01
R1783:Dsg2 UTSW 18 20591880 missense probably benign 0.01
R1946:Dsg2 UTSW 18 20580548 missense probably damaging 1.00
R1991:Dsg2 UTSW 18 20601473 missense probably damaging 1.00
R1992:Dsg2 UTSW 18 20601473 missense probably damaging 1.00
R2027:Dsg2 UTSW 18 20583004 unclassified probably benign
R2109:Dsg2 UTSW 18 20592289 missense probably benign 0.00
R2143:Dsg2 UTSW 18 20579161 missense probably damaging 1.00
R2201:Dsg2 UTSW 18 20596054 missense probably damaging 1.00
R2343:Dsg2 UTSW 18 20602298 missense probably damaging 0.99
R2937:Dsg2 UTSW 18 20579128 missense probably damaging 1.00
R3710:Dsg2 UTSW 18 20602117 missense probably damaging 1.00
R3734:Dsg2 UTSW 18 20601947 missense probably benign 0.41
R3773:Dsg2 UTSW 18 20591862 missense probably damaging 1.00
R4176:Dsg2 UTSW 18 20580663 missense probably benign 0.25
R4213:Dsg2 UTSW 18 20598514 missense probably benign 0.01
R4299:Dsg2 UTSW 18 20595951 splice site probably null
R4515:Dsg2 UTSW 18 20601387 missense probably benign
R4649:Dsg2 UTSW 18 20602245 missense possibly damaging 0.56
R4940:Dsg2 UTSW 18 20579430 missense probably damaging 1.00
R4949:Dsg2 UTSW 18 20590184 missense probably damaging 1.00
R4998:Dsg2 UTSW 18 20601521 missense probably benign 0.26
R5078:Dsg2 UTSW 18 20596083 critical splice donor site probably null
R5155:Dsg2 UTSW 18 20598658 missense possibly damaging 0.67
R5398:Dsg2 UTSW 18 20579133 missense probably benign 0.45
R5503:Dsg2 UTSW 18 20580651 nonsense probably null
R6133:Dsg2 UTSW 18 20590089 missense probably benign 0.00
R6163:Dsg2 UTSW 18 20598669 critical splice donor site probably null
R6226:Dsg2 UTSW 18 20579449 missense probably damaging 0.98
R6228:Dsg2 UTSW 18 20594293 critical splice donor site probably null
R6241:Dsg2 UTSW 18 20590217 splice site probably null
R6482:Dsg2 UTSW 18 20601314 missense possibly damaging 0.69
R6524:Dsg2 UTSW 18 20583036 missense probably damaging 1.00
R6856:Dsg2 UTSW 18 20601802 missense probably damaging 0.98
R7058:Dsg2 UTSW 18 20592275 missense probably benign 0.00
R7108:Dsg2 UTSW 18 20601863 missense probably damaging 1.00
R7149:Dsg2 UTSW 18 20579454 missense probably damaging 0.98
R7207:Dsg2 UTSW 18 20601459 missense probably damaging 0.99
R7256:Dsg2 UTSW 18 20591931 missense possibly damaging 0.96
R7315:Dsg2 UTSW 18 20579160 missense probably damaging 0.97
R7471:Dsg2 UTSW 18 20580618 missense probably benign 0.08
R7558:Dsg2 UTSW 18 20594234 missense probably benign 0.00
R8094:Dsg2 UTSW 18 20583004 unclassified probably benign
R8118:Dsg2 UTSW 18 20582801 missense probably benign 0.11
R8157:Dsg2 UTSW 18 20580549 missense probably damaging 1.00
R8307:Dsg2 UTSW 18 20575064 missense probably benign 0.19
R8308:Dsg2 UTSW 18 20575064 missense probably benign 0.19
R8488:Dsg2 UTSW 18 20601374 missense probably damaging 1.00
R8669:Dsg2 UTSW 18 20590075 missense probably damaging 1.00
R8675:Dsg2 UTSW 18 20601918 missense possibly damaging 0.75
R8750:Dsg2 UTSW 18 20575012 missense possibly damaging 0.90
R8773:Dsg2 UTSW 18 20582999 missense probably damaging 1.00
R8888:Dsg2 UTSW 18 20590069 missense probably damaging 1.00
R8895:Dsg2 UTSW 18 20590069 missense probably damaging 1.00
R8912:Dsg2 UTSW 18 20582821 missense probably damaging 1.00
R8925:Dsg2 UTSW 18 20592478 missense probably damaging 1.00
R8927:Dsg2 UTSW 18 20592478 missense probably damaging 1.00
R9263:Dsg2 UTSW 18 20594166 missense probably benign 0.33
R9328:Dsg2 UTSW 18 20582790 missense possibly damaging 0.81
Z1176:Dsg2 UTSW 18 20580621 missense probably damaging 1.00
Z1177:Dsg2 UTSW 18 20602249 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTCCCTGGTGAAATCATGATTTGG -3'
(R):5'- ACTTCTGGTGAGTAATATCCAGC -3'

Sequencing Primer
(F):5'- CTGGTGAAATCATGATTTGGTTTATG -3'
(R):5'- TCCACAGATCAGGTGATGGCTTAC -3'
Posted On 2021-01-18