Incidental Mutation 'R8520:Wdr7'
ID 658614
Institutional Source Beutler Lab
Gene Symbol Wdr7
Ensembl Gene ENSMUSG00000040560
Gene Name WD repeat domain 7
Synonyms TGF-beta resistance associated gene, TRAG
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.914) question?
Stock # R8520 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 63708695-63989760 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 63987160 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1424 (N1424S)
Ref Sequence ENSEMBL: ENSMUSP00000072509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072726]
AlphaFold Q920I9
Predicted Effect probably benign
Transcript: ENSMUST00000072726
AA Change: N1424S

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000072509
Gene: ENSMUSG00000040560
AA Change: N1424S

DomainStartEndE-ValueType
WD40 5 47 1.2e-2 SMART
WD40 53 95 3.71e-1 SMART
Blast:WD40 145 190 1e-18 BLAST
WD40 208 242 1.77e2 SMART
WD40 453 498 3.81e-5 SMART
WD40 501 546 4.26e1 SMART
WD40 549 588 1.63e-4 SMART
low complexity region 760 777 N/A INTRINSIC
low complexity region 915 927 N/A INTRINSIC
low complexity region 956 970 N/A INTRINSIC
low complexity region 1020 1040 N/A INTRINSIC
low complexity region 1181 1192 N/A INTRINSIC
Blast:WD40 1341 1380 5e-20 BLAST
WD40 1382 1422 2.73e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) that may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein forms the beta subunit of rabconnectin-3 and binds directly with Rab3A GDP/GTP exchange protein and indirectly with Rab3A GDP/GTP activating protein; these proteins are regulators of Rab3 small G protein family members involved in control of the calcium-dependant exocytosis of neurotransmitters. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,609 F136L possibly damaging Het
A430033K04Rik T A 5: 138,646,706 N284K possibly damaging Het
Abcb1a T C 5: 8,685,346 I151T possibly damaging Het
Adam28 C T 14: 68,642,083 G172D probably damaging Het
Adcy6 A G 15: 98,604,160 V191A probably benign Het
Ankrd52 T C 10: 128,389,490 L911P probably damaging Het
C5ar1 A G 7: 16,248,151 S315P probably damaging Het
Cubn A G 2: 13,308,520 probably null Het
Dlec1 T C 9: 119,112,209 S276P probably benign Het
Dnah14 T A 1: 181,653,638 I1564N probably damaging Het
Dsg2 G A 18: 20,579,451 G171R probably damaging Het
Dusp13 C A 14: 21,743,470 G208* probably null Het
Ebf3 A C 7: 137,201,124 probably null Het
Fbn2 A T 18: 58,038,198 probably null Het
Fbxo27 A G 7: 28,693,342 D16G probably benign Het
G6pc3 A G 11: 102,193,108 S187G probably benign Het
Gucy2d G A 7: 98,472,306 V995I probably null Het
Hmcn2 C A 2: 31,354,714 P728T probably damaging Het
Il1r2 T C 1: 40,105,339 L62P probably damaging Het
Ints7 T C 1: 191,582,491 S63P probably damaging Het
Mcf2l C A 8: 12,880,089 D36E probably benign Het
Mfsd13b T G 7: 120,991,363 I109S probably benign Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Mydgf C A 17: 56,183,734 probably null Het
Nanog A T 6: 122,713,516 L268F possibly damaging Het
Olfr305 A T 7: 86,364,263 C25S probably benign Het
Olfr536 T A 7: 140,504,402 D19V probably benign Het
Otud4 T A 8: 79,659,267 N256K probably damaging Het
P2rx1 A T 11: 73,008,953 D128V probably benign Het
Pappa G A 4: 65,335,764 V1552I probably benign Het
Pax8 A T 2: 24,443,022 F103I probably damaging Het
Ptk2b T A 14: 66,174,755 S396C probably damaging Het
Rnf148 A G 6: 23,654,170 Y276H probably damaging Het
Sec11c A T 18: 65,814,840 I93L probably damaging Het
Serpinb2 T A 1: 107,523,180 N217K probably benign Het
Slc2a13 T A 15: 91,572,902 T66S probably damaging Het
Slc4a3 T C 1: 75,549,862 M9T probably benign Het
Sord G A 2: 122,256,942 V176I possibly damaging Het
Thbs4 G A 13: 92,754,284 Q892* probably null Het
Thsd7b T A 1: 129,921,420 D956E probably benign Het
Tmem251 T A 12: 102,744,172 probably null Het
Topbp1 T A 9: 103,308,977 probably null Het
Tst T C 15: 78,405,253 E194G probably damaging Het
Ttk T A 9: 83,857,327 S484T possibly damaging Het
U2surp A G 9: 95,502,554 S26P possibly damaging Het
Ugt2b37 C T 5: 87,240,855 A500T probably benign Het
Utrn A T 10: 12,670,186 Y1669* probably null Het
Vmn2r23 A T 6: 123,741,656 Q656L probably damaging Het
Xkr9 A G 1: 13,701,379 D373G probably benign Het
Zfp984 T A 4: 147,756,211 Y61F probably benign Het
Other mutations in Wdr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Wdr7 APN 18 63720775 missense possibly damaging 0.83
IGL00708:Wdr7 APN 18 63778033 missense probably benign 0.42
IGL00813:Wdr7 APN 18 63735604 missense possibly damaging 0.84
IGL00840:Wdr7 APN 18 63927327 missense possibly damaging 0.80
IGL00904:Wdr7 APN 18 63796231 missense probably benign 0.43
IGL00930:Wdr7 APN 18 63740244 nonsense probably null
IGL01481:Wdr7 APN 18 63739179 missense probably damaging 1.00
IGL02121:Wdr7 APN 18 63777545 nonsense probably null
IGL02346:Wdr7 APN 18 63865336 missense probably benign 0.09
IGL02454:Wdr7 APN 18 63796228 missense probably benign 0.20
IGL02538:Wdr7 APN 18 63796235 missense probably benign 0.01
IGL02870:Wdr7 APN 18 63791843 missense probably benign
IGL03054:Wdr7 APN 18 63825121 splice site probably benign
IGL03189:Wdr7 APN 18 63760601 missense probably benign 0.17
R0014:Wdr7 UTSW 18 63904101 missense probably benign 0.03
R0022:Wdr7 UTSW 18 63777634 missense probably damaging 1.00
R0233:Wdr7 UTSW 18 63904101 missense probably benign 0.03
R0432:Wdr7 UTSW 18 63796249 missense probably damaging 0.96
R0496:Wdr7 UTSW 18 63791843 missense probably benign
R0633:Wdr7 UTSW 18 63865300 missense probably benign 0.00
R0931:Wdr7 UTSW 18 63865300 missense probably benign 0.00
R1585:Wdr7 UTSW 18 63924918 missense probably benign 0.03
R1651:Wdr7 UTSW 18 63720776 nonsense probably null
R1804:Wdr7 UTSW 18 63865440 missense probably damaging 1.00
R1874:Wdr7 UTSW 18 63728504 missense probably benign 0.02
R1985:Wdr7 UTSW 18 63760583 frame shift probably null
R2106:Wdr7 UTSW 18 63778038 missense probably damaging 1.00
R2206:Wdr7 UTSW 18 63777607 missense possibly damaging 0.95
R2207:Wdr7 UTSW 18 63777607 missense possibly damaging 0.95
R2245:Wdr7 UTSW 18 63924909 missense possibly damaging 0.60
R2407:Wdr7 UTSW 18 63760723 missense probably benign
R3804:Wdr7 UTSW 18 63720836 missense probably benign
R3880:Wdr7 UTSW 18 63724155 missense possibly damaging 0.92
R4410:Wdr7 UTSW 18 63778249 missense probably damaging 1.00
R4441:Wdr7 UTSW 18 63755210 missense probably damaging 1.00
R4485:Wdr7 UTSW 18 63777550 missense possibly damaging 0.89
R4606:Wdr7 UTSW 18 63779945 nonsense probably null
R4607:Wdr7 UTSW 18 63777580 missense probably benign 0.28
R4608:Wdr7 UTSW 18 63777580 missense probably benign 0.28
R4711:Wdr7 UTSW 18 63728465 missense probably benign
R4852:Wdr7 UTSW 18 63777949 missense probably damaging 0.98
R5197:Wdr7 UTSW 18 63738866 missense probably benign 0.02
R5213:Wdr7 UTSW 18 63755126 missense probably damaging 1.00
R5280:Wdr7 UTSW 18 63987312 missense probably benign 0.35
R5378:Wdr7 UTSW 18 63825239 critical splice donor site probably null
R6076:Wdr7 UTSW 18 63739277 missense probably damaging 1.00
R6083:Wdr7 UTSW 18 63728469 missense probably damaging 1.00
R6168:Wdr7 UTSW 18 63777977 missense probably damaging 0.98
R6234:Wdr7 UTSW 18 63724132 missense probably damaging 1.00
R6295:Wdr7 UTSW 18 63755111 missense probably damaging 1.00
R6548:Wdr7 UTSW 18 63778251 missense possibly damaging 0.87
R6566:Wdr7 UTSW 18 63755055 missense possibly damaging 0.72
R6696:Wdr7 UTSW 18 63739330 missense probably benign 0.07
R6937:Wdr7 UTSW 18 63791867 missense probably benign
R6962:Wdr7 UTSW 18 63865288 missense possibly damaging 0.74
R7162:Wdr7 UTSW 18 63724139 missense possibly damaging 0.92
R7376:Wdr7 UTSW 18 63777620 missense probably damaging 1.00
R7423:Wdr7 UTSW 18 63777380 splice site probably null
R7781:Wdr7 UTSW 18 63777789 nonsense probably null
R7851:Wdr7 UTSW 18 63720327 missense probably benign 0.05
R7962:Wdr7 UTSW 18 63904086 missense probably damaging 1.00
R8310:Wdr7 UTSW 18 63735685 missense probably damaging 0.98
R8325:Wdr7 UTSW 18 63778464 splice site probably null
R8678:Wdr7 UTSW 18 63777697 missense probably damaging 1.00
R8847:Wdr7 UTSW 18 63739222 missense probably damaging 1.00
R9326:Wdr7 UTSW 18 63739189 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CACAAAGGAAATTTTCTCCAGGC -3'
(R):5'- GGTGTTCCTTCCCATCATGG -3'

Sequencing Primer
(F):5'- GTGTTCACGTCAATGGAGTCATAACC -3'
(R):5'- TCATGGGCCATGAGGATAACATTCC -3'
Posted On 2021-01-18