Mutagenetix > Incidental Mutations

Incidental Mutation 'R8520:Wdr7'

658614

Institutional Source

Beutler Lab

Gene Symbol

Wdr7

Ensembl Gene

ENSMUSG00000040560

Gene Name

WD repeat domain 7

Synonyms

TGF-beta resistance associated gene, TRAG

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.914) question?

Stock #

R8520 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63708695-63989760 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 63987160 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1424 (N1424S)

Ref Sequence

ENSEMBL: ENSMUSP00000072509 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072726]

AlphaFold

Q920I9

Predicted Effect

probably benign
Transcript: ENSMUST00000072726
AA Change: N1424S

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000072509
Gene: ENSMUSG00000040560
AA Change: N1424S

Domain	Start	End	E-Value	Type
WD40	5	47	1.2e-2	SMART
WD40	53	95	3.71e-1	SMART
Blast:WD40	145	190	1e-18	BLAST
WD40	208	242	1.77e2	SMART
WD40	453	498	3.81e-5	SMART
WD40	501	546	4.26e1	SMART
WD40	549	588	1.63e-4	SMART
low complexity region	760	777	N/A	INTRINSIC
low complexity region	915	927	N/A	INTRINSIC
low complexity region	956	970	N/A	INTRINSIC
low complexity region	1020	1040	N/A	INTRINSIC
low complexity region	1181	1192	N/A	INTRINSIC
Blast:WD40	1341	1380	5e-20	BLAST
WD40	1382	1422	2.73e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) that may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein forms the beta subunit of rabconnectin-3 and binds directly with Rab3A GDP/GTP exchange protein and indirectly with Rab3A GDP/GTP activating protein; these proteins are regulators of Rab3 small G protein family members involved in control of the calcium-dependant exocytosis of neurotransmitters. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	T	13: 59,690,609	F136L	possibly damaging	Het
A430033K04Rik	T	A	5: 138,646,706	N284K	possibly damaging	Het
Abcb1a	T	C	5: 8,685,346	I151T	possibly damaging	Het
Adam28	C	T	14: 68,642,083	G172D	probably damaging	Het
Adcy6	A	G	15: 98,604,160	V191A	probably benign	Het
Ankrd52	T	C	10: 128,389,490	L911P	probably damaging	Het
C5ar1	A	G	7: 16,248,151	S315P	probably damaging	Het
Cubn	A	G	2: 13,308,520		probably null	Het
Dlec1	T	C	9: 119,112,209	S276P	probably benign	Het
Dnah14	T	A	1: 181,653,638	I1564N	probably damaging	Het
Dsg2	G	A	18: 20,579,451	G171R	probably damaging	Het
Dusp13	C	A	14: 21,743,470	G208*	probably null	Het
Ebf3	A	C	7: 137,201,124		probably null	Het
Fbn2	A	T	18: 58,038,198		probably null	Het
Fbxo27	A	G	7: 28,693,342	D16G	probably benign	Het
G6pc3	A	G	11: 102,193,108	S187G	probably benign	Het
Gucy2d	G	A	7: 98,472,306	V995I	probably null	Het
Hmcn2	C	A	2: 31,354,714	P728T	probably damaging	Het
Il1r2	T	C	1: 40,105,339	L62P	probably damaging	Het
Ints7	T	C	1: 191,582,491	S63P	probably damaging	Het
Mcf2l	C	A	8: 12,880,089	D36E	probably benign	Het
Mfsd13b	T	G	7: 120,991,363	I109S	probably benign	Het
Mier2	G	A	10: 79,542,429	H385Y	possibly damaging	Het
Mydgf	C	A	17: 56,183,734		probably null	Het
Nanog	A	T	6: 122,713,516	L268F	possibly damaging	Het
Olfr305	A	T	7: 86,364,263	C25S	probably benign	Het
Olfr536	T	A	7: 140,504,402	D19V	probably benign	Het
Otud4	T	A	8: 79,659,267	N256K	probably damaging	Het
P2rx1	A	T	11: 73,008,953	D128V	probably benign	Het
Pappa	G	A	4: 65,335,764	V1552I	probably benign	Het
Pax8	A	T	2: 24,443,022	F103I	probably damaging	Het
Ptk2b	T	A	14: 66,174,755	S396C	probably damaging	Het
Rnf148	A	G	6: 23,654,170	Y276H	probably damaging	Het
Sec11c	A	T	18: 65,814,840	I93L	probably damaging	Het
Serpinb2	T	A	1: 107,523,180	N217K	probably benign	Het
Slc2a13	T	A	15: 91,572,902	T66S	probably damaging	Het
Slc4a3	T	C	1: 75,549,862	M9T	probably benign	Het
Sord	G	A	2: 122,256,942	V176I	possibly damaging	Het
Thbs4	G	A	13: 92,754,284	Q892*	probably null	Het
Thsd7b	T	A	1: 129,921,420	D956E	probably benign	Het
Tmem251	T	A	12: 102,744,172		probably null	Het
Topbp1	T	A	9: 103,308,977		probably null	Het
Tst	T	C	15: 78,405,253	E194G	probably damaging	Het
Ttk	T	A	9: 83,857,327	S484T	possibly damaging	Het
U2surp	A	G	9: 95,502,554	S26P	possibly damaging	Het
Ugt2b37	C	T	5: 87,240,855	A500T	probably benign	Het
Utrn	A	T	10: 12,670,186	Y1669*	probably null	Het
Vmn2r23	A	T	6: 123,741,656	Q656L	probably damaging	Het
Xkr9	A	G	1: 13,701,379	D373G	probably benign	Het
Zfp984	T	A	4: 147,756,211	Y61F	probably benign	Het

Other mutations in Wdr7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:Wdr7	APN	18	63720775	missense	possibly damaging	0.83
IGL00708:Wdr7	APN	18	63778033	missense	probably benign	0.42
IGL00813:Wdr7	APN	18	63735604	missense	possibly damaging	0.84
IGL00840:Wdr7	APN	18	63927327	missense	possibly damaging	0.80
IGL00904:Wdr7	APN	18	63796231	missense	probably benign	0.43
IGL00930:Wdr7	APN	18	63740244	nonsense	probably null
IGL01481:Wdr7	APN	18	63739179	missense	probably damaging	1.00
IGL02121:Wdr7	APN	18	63777545	nonsense	probably null
IGL02346:Wdr7	APN	18	63865336	missense	probably benign	0.09
IGL02454:Wdr7	APN	18	63796228	missense	probably benign	0.20
IGL02538:Wdr7	APN	18	63796235	missense	probably benign	0.01
IGL02870:Wdr7	APN	18	63791843	missense	probably benign
IGL03054:Wdr7	APN	18	63825121	splice site	probably benign
IGL03189:Wdr7	APN	18	63760601	missense	probably benign	0.17
R0014:Wdr7	UTSW	18	63904101	missense	probably benign	0.03
R0022:Wdr7	UTSW	18	63777634	missense	probably damaging	1.00
R0233:Wdr7	UTSW	18	63904101	missense	probably benign	0.03
R0432:Wdr7	UTSW	18	63796249	missense	probably damaging	0.96
R0496:Wdr7	UTSW	18	63791843	missense	probably benign
R0633:Wdr7	UTSW	18	63865300	missense	probably benign	0.00
R0931:Wdr7	UTSW	18	63865300	missense	probably benign	0.00
R1585:Wdr7	UTSW	18	63924918	missense	probably benign	0.03
R1651:Wdr7	UTSW	18	63720776	nonsense	probably null
R1804:Wdr7	UTSW	18	63865440	missense	probably damaging	1.00
R1874:Wdr7	UTSW	18	63728504	missense	probably benign	0.02
R1985:Wdr7	UTSW	18	63760583	frame shift	probably null
R2106:Wdr7	UTSW	18	63778038	missense	probably damaging	1.00
R2206:Wdr7	UTSW	18	63777607	missense	possibly damaging	0.95
R2207:Wdr7	UTSW	18	63777607	missense	possibly damaging	0.95
R2245:Wdr7	UTSW	18	63924909	missense	possibly damaging	0.60
R2407:Wdr7	UTSW	18	63760723	missense	probably benign
R3804:Wdr7	UTSW	18	63720836	missense	probably benign
R3880:Wdr7	UTSW	18	63724155	missense	possibly damaging	0.92
R4410:Wdr7	UTSW	18	63778249	missense	probably damaging	1.00
R4441:Wdr7	UTSW	18	63755210	missense	probably damaging	1.00
R4485:Wdr7	UTSW	18	63777550	missense	possibly damaging	0.89
R4606:Wdr7	UTSW	18	63779945	nonsense	probably null
R4607:Wdr7	UTSW	18	63777580	missense	probably benign	0.28
R4608:Wdr7	UTSW	18	63777580	missense	probably benign	0.28
R4711:Wdr7	UTSW	18	63728465	missense	probably benign
R4852:Wdr7	UTSW	18	63777949	missense	probably damaging	0.98
R5197:Wdr7	UTSW	18	63738866	missense	probably benign	0.02
R5213:Wdr7	UTSW	18	63755126	missense	probably damaging	1.00
R5280:Wdr7	UTSW	18	63987312	missense	probably benign	0.35
R5378:Wdr7	UTSW	18	63825239	critical splice donor site	probably null
R6076:Wdr7	UTSW	18	63739277	missense	probably damaging	1.00
R6083:Wdr7	UTSW	18	63728469	missense	probably damaging	1.00
R6168:Wdr7	UTSW	18	63777977	missense	probably damaging	0.98
R6234:Wdr7	UTSW	18	63724132	missense	probably damaging	1.00
R6295:Wdr7	UTSW	18	63755111	missense	probably damaging	1.00
R6548:Wdr7	UTSW	18	63778251	missense	possibly damaging	0.87
R6566:Wdr7	UTSW	18	63755055	missense	possibly damaging	0.72
R6696:Wdr7	UTSW	18	63739330	missense	probably benign	0.07
R6937:Wdr7	UTSW	18	63791867	missense	probably benign
R6962:Wdr7	UTSW	18	63865288	missense	possibly damaging	0.74
R7162:Wdr7	UTSW	18	63724139	missense	possibly damaging	0.92
R7376:Wdr7	UTSW	18	63777620	missense	probably damaging	1.00
R7423:Wdr7	UTSW	18	63777380	splice site	probably null
R7781:Wdr7	UTSW	18	63777789	nonsense	probably null
R7851:Wdr7	UTSW	18	63720327	missense	probably benign	0.05
R7962:Wdr7	UTSW	18	63904086	missense	probably damaging	1.00
R8310:Wdr7	UTSW	18	63735685	missense	probably damaging	0.98
R8325:Wdr7	UTSW	18	63778464	splice site	probably null
R8678:Wdr7	UTSW	18	63777697	missense	probably damaging	1.00
R8847:Wdr7	UTSW	18	63739222	missense	probably damaging	1.00
R9326:Wdr7	UTSW	18	63739189	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- CACAAAGGAAATTTTCTCCAGGC -3'
(R):5'- GGTGTTCCTTCCCATCATGG -3'

Sequencing Primer
(F):5'- GTGTTCACGTCAATGGAGTCATAACC -3'
(R):5'- TCATGGGCCATGAGGATAACATTCC -3'

Posted On

2021-01-18