Incidental Mutation 'R8523:Rab36'
ID658661
Institutional Source Beutler Lab
Gene Symbol Rab36
Ensembl Gene ENSMUSG00000020175
Gene NameRAB36, member RAS oncogene family
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8523 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location75037058-75054748 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75052503 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 260 (R260G)
Ref Sequence ENSEMBL: ENSMUSP00000119399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000139384] [ENSMUST00000146440] [ENSMUST00000147802]
Predicted Effect probably benign
Transcript: ENSMUST00000139384
SMART Domains Protein: ENSMUSP00000118718
Gene: ENSMUSG00000020175

DomainStartEndE-ValueType
Pfam:Arf 42 134 6.3e-8 PFAM
Pfam:Ras 74 134 1.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146440
AA Change: R260G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121693
Gene: ENSMUSG00000020175
AA Change: R260G

DomainStartEndE-ValueType
RAB 59 224 6.4e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147802
AA Change: R260G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119399
Gene: ENSMUSG00000020175
AA Change: R260G

DomainStartEndE-ValueType
RAB 59 224 6.4e-45 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Ammecr1l T C 18: 31,772,099 F131S probably damaging Het
Apbb1ip A C 2: 22,819,636 D35A unknown Het
Arhgap12 A T 18: 6,111,976 D129E probably benign Het
Arpc1b A G 5: 145,124,682 D163G probably damaging Het
Atxn7l1 A T 12: 33,346,024 T251S probably benign Het
BC030499 A T 11: 78,293,384 M225L probably benign Het
Best1 T C 19: 9,991,663 I230V possibly damaging Het
Brca2 A G 5: 150,560,148 T2888A possibly damaging Het
Cad T C 5: 31,058,106 V87A probably damaging Het
Ccdc39 C T 3: 33,815,411 probably null Het
Clcn1 T A 6: 42,307,589 C548* probably null Het
Col18a1 A G 10: 77,054,234 S1678P probably damaging Het
Col6a6 T C 9: 105,774,788 N1008S possibly damaging Het
Defb41 A T 1: 18,251,295 C32S possibly damaging Het
Dnah6 T C 6: 73,095,188 N2437S probably damaging Het
Drosha T C 15: 12,834,322 Y171H unknown Het
Ehd1 T C 19: 6,294,583 L291P probably damaging Het
Eif3c A T 7: 126,547,897 H734Q possibly damaging Het
Erich5 A T 15: 34,471,356 T244S probably benign Het
Fam186b T A 15: 99,279,732 H571L probably benign Het
Fer1l5 A G 1: 36,387,190 K360E probably benign Het
Fga A T 3: 83,030,851 I178F probably damaging Het
Gale A T 4: 135,967,676 T320S probably benign Het
Gm11232 A T 4: 71,757,228 S99T probably benign Het
Gm8251 A T 1: 44,060,834 I368K possibly damaging Het
Gpr137 C T 19: 6,940,435 W94* probably null Het
Grm7 T A 6: 111,246,319 M440K possibly damaging Het
Hacd4 A G 4: 88,435,049 F69L probably damaging Het
Hdac7 T A 15: 97,808,370 H304L probably damaging Het
Herc1 T A 9: 66,450,942 I2435N probably benign Het
Itgb7 G A 15: 102,216,522 R755W probably damaging Het
Kdm3b G T 18: 34,793,076 A90S probably benign Het
Mcmdc2 G A 1: 9,911,721 M1I probably null Het
Mitd1 A G 1: 37,879,558 probably null Het
Myh10 A T 11: 68,797,409 Q1232L probably benign Het
Myo1a C A 10: 127,711,158 N362K probably damaging Het
N4bp1 G A 8: 86,853,161 T671I probably damaging Het
Nav3 A T 10: 109,823,277 D826E probably damaging Het
Negr1 C T 3: 157,160,660 T282M probably damaging Het
Notch1 G A 2: 26,464,905 H1837Y possibly damaging Het
Olfr1025-ps1 T A 2: 85,918,063 I46N probably damaging Het
Olfr164 A T 16: 19,286,101 V214E probably benign Het
Olfr603 A T 7: 103,383,206 F265L probably benign Het
Olfr873 A G 9: 20,300,797 N200S probably benign Het
Pard6a T C 8: 105,702,249 C47R probably benign Het
Parp2 T C 14: 50,819,790 probably null Het
Pck1 C A 2: 173,157,271 A410D probably damaging Het
Pdzph1 G A 17: 58,884,013 L85F probably damaging Het
Piezo2 A G 18: 63,146,802 S1P probably damaging Het
Pld1 T A 3: 28,085,876 V615D probably damaging Het
Plekha7 T G 7: 116,307,929 I23L probably benign Het
Prkcz T G 4: 155,262,511 D388A probably damaging Het
Reln C A 5: 22,004,231 R1116S probably damaging Het
Rundc3b T G 5: 8,569,505 K151Q probably damaging Het
Scaf11 A G 15: 96,419,107 S859P probably damaging Het
Slc25a32 C T 15: 39,099,886 R180H probably benign Het
Slc4a9 G A 18: 36,532,143 G443E possibly damaging Het
Slmap T A 14: 26,429,810 K534N probably damaging Het
Sncaip G A 18: 52,838,016 A3T probably damaging Het
Spata31d1c G T 13: 65,033,177 S30I probably damaging Het
Srrm1 A T 4: 135,324,002 V789E unknown Het
Srrm2 A T 17: 23,808,515 probably benign Het
St7l T C 3: 104,868,057 F83S probably damaging Het
Taf15 C T 11: 83,484,852 Q48* probably null Het
Tek A T 4: 94,799,166 D172V probably benign Het
Tmem232 T C 17: 65,478,371 Y198C probably damaging Het
Tns3 A T 11: 8,448,779 V1191E probably damaging Het
Togaram1 A G 12: 65,020,314 D1710G probably damaging Het
Trav16d-dv11 T C 14: 53,047,665 I66T probably benign Het
Ttn T A 2: 76,746,945 T24535S possibly damaging Het
Ttn A T 2: 76,899,743 L911* probably null Het
Ube4a A G 9: 44,949,832 S227P probably damaging Het
Ubqln1 T C 13: 58,191,755 T352A probably benign Het
Vmn1r174 C T 7: 23,754,757 P283S probably damaging Het
Vmn1r59 T C 7: 5,454,054 T236A probably damaging Het
Vmn2r3 T C 3: 64,274,890 I463V probably benign Het
Wdr95 A G 5: 149,573,996 D213G probably damaging Het
Zbtb49 T A 5: 38,213,325 H404L probably damaging Het
Zfp879 A G 11: 50,837,930 M79T probably benign Het
Zmiz2 G A 11: 6,402,441 C600Y probably damaging Het
Other mutations in Rab36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Rab36 APN 10 75048466 missense probably damaging 1.00
IGL01554:Rab36 APN 10 75050688 missense possibly damaging 0.50
IGL02197:Rab36 APN 10 75052042 missense probably damaging 0.96
R2022:Rab36 UTSW 10 75052474 missense probably benign 0.13
R2907:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R2991:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3012:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3033:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3034:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3035:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3036:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3440:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3686:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3687:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3688:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4398:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4426:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4427:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4433:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4456:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4457:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4467:Rab36 UTSW 10 75052043 nonsense probably null
R4689:Rab36 UTSW 10 75041933 critical splice donor site probably null
R5043:Rab36 UTSW 10 75051005 missense probably benign 0.00
R5568:Rab36 UTSW 10 75052479 missense probably benign
R8354:Rab36 UTSW 10 75048459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCTTACCTGAATGCCAC -3'
(R):5'- ATCAACCAACCGGGCAGTATG -3'

Sequencing Primer
(F):5'- ACTCCCAAGTATCCCCTGGG -3'
(R):5'- CAGTATGGGGCTTCAGCAG -3'
Posted On2021-01-18