Incidental Mutation 'R8523:Pdzph1'
ID 658687
Institutional Source Beutler Lab
Gene Symbol Pdzph1
Ensembl Gene ENSMUSG00000024227
Gene Name PDZ and pleckstrin homology domains 1
Synonyms 2610034M16Rik
MMRRC Submission 067948-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R8523 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 59185803-59298344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 59191008 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 85 (L85F)
Ref Sequence ENSEMBL: ENSMUSP00000135180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025064] [ENSMUST00000177360]
AlphaFold Q8BGR1
Predicted Effect probably damaging
Transcript: ENSMUST00000025064
AA Change: L1125F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: L1125F

DomainStartEndE-ValueType
Blast:PDZ 780 844 6e-20 BLAST
PDZ 915 984 3.31e-15 SMART
PH 993 1096 9.4e-19 SMART
PH 1120 1218 2.83e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177360
AA Change: L85F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135180
Gene: ENSMUSG00000024227
AA Change: L85F

DomainStartEndE-ValueType
SCOP:d1faoa_ 1 54 1e-4 SMART
Blast:PH 1 56 4e-33 BLAST
PH 80 178 2.83e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 G A 7: 75,380,213 (GRCm39) R462H probably damaging Het
Ammecr1l T C 18: 31,905,152 (GRCm39) F131S probably damaging Het
Apbb1ip A C 2: 22,709,648 (GRCm39) D35A unknown Het
Arhgap12 A T 18: 6,111,976 (GRCm39) D129E probably benign Het
Arpc1b A G 5: 145,061,492 (GRCm39) D163G probably damaging Het
Atxn7l1 A T 12: 33,396,023 (GRCm39) T251S probably benign Het
Best1 T C 19: 9,969,027 (GRCm39) I230V possibly damaging Het
Brca2 A G 5: 150,483,613 (GRCm39) T2888A possibly damaging Het
Cad T C 5: 31,215,450 (GRCm39) V87A probably damaging Het
Ccdc168 A T 1: 44,099,994 (GRCm39) I368K possibly damaging Het
Ccdc39 C T 3: 33,869,560 (GRCm39) probably null Het
Clcn1 T A 6: 42,284,523 (GRCm39) C548* probably null Het
Col18a1 A G 10: 76,890,068 (GRCm39) S1678P probably damaging Het
Col6a6 T C 9: 105,651,987 (GRCm39) N1008S possibly damaging Het
Defb41 A T 1: 18,321,519 (GRCm39) C32S possibly damaging Het
Dnah6 T C 6: 73,072,171 (GRCm39) N2437S probably damaging Het
Drosha T C 15: 12,834,408 (GRCm39) Y171H unknown Het
Ehd1 T C 19: 6,344,613 (GRCm39) L291P probably damaging Het
Eif3c A T 7: 126,147,069 (GRCm39) H734Q possibly damaging Het
Erich5 A T 15: 34,471,502 (GRCm39) T244S probably benign Het
Fam186b T A 15: 99,177,613 (GRCm39) H571L probably benign Het
Fer1l5 A G 1: 36,426,271 (GRCm39) K360E probably benign Het
Fga A T 3: 82,938,158 (GRCm39) I178F probably damaging Het
Gale A T 4: 135,694,987 (GRCm39) T320S probably benign Het
Gm11232 A T 4: 71,675,465 (GRCm39) S99T probably benign Het
Gpr137 C T 19: 6,917,803 (GRCm39) W94* probably null Het
Grm7 T A 6: 111,223,280 (GRCm39) M440K possibly damaging Het
Hacd4 A G 4: 88,353,286 (GRCm39) F69L probably damaging Het
Hdac7 T A 15: 97,706,251 (GRCm39) H304L probably damaging Het
Herc1 T A 9: 66,358,224 (GRCm39) I2435N probably benign Het
Itgb7 G A 15: 102,124,957 (GRCm39) R755W probably damaging Het
Kdm3b G T 18: 34,926,129 (GRCm39) A90S probably benign Het
Mcmdc2 G A 1: 9,981,946 (GRCm39) M1I probably null Het
Mitd1 A G 1: 37,918,639 (GRCm39) probably null Het
Myh10 A T 11: 68,688,235 (GRCm39) Q1232L probably benign Het
Myo1a C A 10: 127,547,027 (GRCm39) N362K probably damaging Het
N4bp1 G A 8: 87,579,789 (GRCm39) T671I probably damaging Het
Nav3 A T 10: 109,659,138 (GRCm39) D826E probably damaging Het
Negr1 C T 3: 156,866,297 (GRCm39) T282M probably damaging Het
Notch1 G A 2: 26,354,917 (GRCm39) H1837Y possibly damaging Het
Or2m12 A T 16: 19,104,851 (GRCm39) V214E probably benign Het
Or52e19b A T 7: 103,032,413 (GRCm39) F265L probably benign Het
Or5m13 T A 2: 85,748,407 (GRCm39) I46N probably damaging Het
Or7e177 A G 9: 20,212,093 (GRCm39) N200S probably benign Het
Pard6a T C 8: 106,428,881 (GRCm39) C47R probably benign Het
Parp2 T C 14: 51,057,247 (GRCm39) probably null Het
Pck1 C A 2: 172,999,064 (GRCm39) A410D probably damaging Het
Piezo2 A G 18: 63,279,873 (GRCm39) S1P probably damaging Het
Pld1 T A 3: 28,140,025 (GRCm39) V615D probably damaging Het
Plekha7 T G 7: 115,907,164 (GRCm39) I23L probably benign Het
Prkcz T G 4: 155,346,968 (GRCm39) D388A probably damaging Het
Rab36 A G 10: 74,888,335 (GRCm39) R260G probably benign Het
Reln C A 5: 22,209,229 (GRCm39) R1116S probably damaging Het
Rskr A T 11: 78,184,210 (GRCm39) M225L probably benign Het
Rundc3b T G 5: 8,619,505 (GRCm39) K151Q probably damaging Het
Scaf11 A G 15: 96,316,988 (GRCm39) S859P probably damaging Het
Slc25a32 C T 15: 38,963,281 (GRCm39) R180H probably benign Het
Slc4a9 G A 18: 36,665,196 (GRCm39) G443E possibly damaging Het
Slmap T A 14: 26,150,965 (GRCm39) K534N probably damaging Het
Sncaip G A 18: 52,971,088 (GRCm39) A3T probably damaging Het
Spata31d1c G T 13: 65,180,991 (GRCm39) S30I probably damaging Het
Srrm1 A T 4: 135,051,313 (GRCm39) V789E unknown Het
Srrm2 A T 17: 24,027,489 (GRCm39) probably benign Het
St7l T C 3: 104,775,373 (GRCm39) F83S probably damaging Het
Taf15 C T 11: 83,375,678 (GRCm39) Q48* probably null Het
Tek A T 4: 94,687,403 (GRCm39) D172V probably benign Het
Tmem232 T C 17: 65,785,366 (GRCm39) Y198C probably damaging Het
Tns3 A T 11: 8,398,779 (GRCm39) V1191E probably damaging Het
Togaram1 A G 12: 65,067,088 (GRCm39) D1710G probably damaging Het
Trav16d-dv11 T C 14: 53,285,122 (GRCm39) I66T probably benign Het
Ttn T A 2: 76,577,289 (GRCm39) T24535S possibly damaging Het
Ttn A T 2: 76,730,087 (GRCm39) L911* probably null Het
Ube4a A G 9: 44,861,130 (GRCm39) S227P probably damaging Het
Ubqln1 T C 13: 58,339,569 (GRCm39) T352A probably benign Het
Vmn1r174 C T 7: 23,454,182 (GRCm39) P283S probably damaging Het
Vmn1r59 T C 7: 5,457,053 (GRCm39) T236A probably damaging Het
Vmn2r3 T C 3: 64,182,311 (GRCm39) I463V probably benign Het
Wdr95 A G 5: 149,497,461 (GRCm39) D213G probably damaging Het
Zbtb49 T A 5: 38,370,669 (GRCm39) H404L probably damaging Het
Zfp879 A G 11: 50,728,757 (GRCm39) M79T probably benign Het
Zmiz2 G A 11: 6,352,441 (GRCm39) C600Y probably damaging Het
Other mutations in Pdzph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Pdzph1 APN 17 59,281,791 (GRCm39) missense possibly damaging 0.46
IGL00644:Pdzph1 APN 17 59,195,105 (GRCm39) missense probably benign
IGL01413:Pdzph1 APN 17 59,186,147 (GRCm39) missense possibly damaging 0.82
IGL01530:Pdzph1 APN 17 59,229,710 (GRCm39) missense probably damaging 1.00
IGL02089:Pdzph1 APN 17 59,274,334 (GRCm39) missense possibly damaging 0.92
IGL02201:Pdzph1 APN 17 59,274,506 (GRCm39) splice site probably benign
IGL02548:Pdzph1 APN 17 59,280,386 (GRCm39) missense probably benign 0.10
IGL02618:Pdzph1 APN 17 59,186,068 (GRCm39) utr 3 prime probably benign
IGL02660:Pdzph1 APN 17 59,187,642 (GRCm39) missense probably damaging 0.97
IGL02749:Pdzph1 APN 17 59,239,478 (GRCm39) missense possibly damaging 0.95
IGL02876:Pdzph1 APN 17 59,281,064 (GRCm39) missense probably benign
IGL03304:Pdzph1 APN 17 59,187,641 (GRCm39) missense probably damaging 1.00
IGL03336:Pdzph1 APN 17 59,281,229 (GRCm39) missense probably benign 0.00
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0498:Pdzph1 UTSW 17 59,280,825 (GRCm39) missense probably benign 0.00
R0553:Pdzph1 UTSW 17 59,229,722 (GRCm39) missense probably damaging 1.00
R0594:Pdzph1 UTSW 17 59,261,474 (GRCm39) missense possibly damaging 0.76
R1306:Pdzph1 UTSW 17 59,239,427 (GRCm39) missense possibly damaging 0.90
R1370:Pdzph1 UTSW 17 59,281,082 (GRCm39) missense possibly damaging 0.73
R1382:Pdzph1 UTSW 17 59,281,742 (GRCm39) missense probably benign 0.10
R1463:Pdzph1 UTSW 17 59,239,440 (GRCm39) missense probably damaging 1.00
R1766:Pdzph1 UTSW 17 59,280,747 (GRCm39) missense probably benign 0.16
R1773:Pdzph1 UTSW 17 59,281,808 (GRCm39) missense probably damaging 0.98
R1862:Pdzph1 UTSW 17 59,229,578 (GRCm39) missense probably damaging 1.00
R2070:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2071:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2229:Pdzph1 UTSW 17 59,239,407 (GRCm39) splice site probably benign
R2264:Pdzph1 UTSW 17 59,195,162 (GRCm39) critical splice acceptor site probably null
R2334:Pdzph1 UTSW 17 59,229,644 (GRCm39) missense probably damaging 1.00
R3750:Pdzph1 UTSW 17 59,280,331 (GRCm39) nonsense probably null
R4700:Pdzph1 UTSW 17 59,281,541 (GRCm39) missense probably damaging 0.98
R4847:Pdzph1 UTSW 17 59,280,525 (GRCm39) missense possibly damaging 0.95
R4868:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
R5130:Pdzph1 UTSW 17 59,229,604 (GRCm39) missense probably damaging 1.00
R5329:Pdzph1 UTSW 17 59,281,875 (GRCm39) missense probably damaging 1.00
R5574:Pdzph1 UTSW 17 59,280,942 (GRCm39) missense probably benign 0.00
R5770:Pdzph1 UTSW 17 59,186,146 (GRCm39) missense probably damaging 1.00
R5795:Pdzph1 UTSW 17 59,192,862 (GRCm39) missense possibly damaging 0.47
R5842:Pdzph1 UTSW 17 59,281,407 (GRCm39) missense possibly damaging 0.64
R5851:Pdzph1 UTSW 17 59,280,741 (GRCm39) missense probably benign 0.02
R6158:Pdzph1 UTSW 17 59,280,622 (GRCm39) missense probably damaging 0.96
R6813:Pdzph1 UTSW 17 59,281,431 (GRCm39) missense probably benign 0.08
R7022:Pdzph1 UTSW 17 59,281,121 (GRCm39) missense probably benign 0.02
R7395:Pdzph1 UTSW 17 59,186,154 (GRCm39) missense possibly damaging 0.85
R7525:Pdzph1 UTSW 17 59,274,336 (GRCm39) missense possibly damaging 0.73
R7944:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7945:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7992:Pdzph1 UTSW 17 59,186,105 (GRCm39) missense possibly damaging 0.71
R8016:Pdzph1 UTSW 17 59,239,476 (GRCm39) missense probably damaging 0.98
R8116:Pdzph1 UTSW 17 59,282,138 (GRCm39) missense probably benign 0.01
R8273:Pdzph1 UTSW 17 59,280,009 (GRCm39) missense probably benign 0.00
R8819:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8820:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8839:Pdzph1 UTSW 17 59,257,237 (GRCm39) missense probably benign 0.02
R8871:Pdzph1 UTSW 17 59,195,033 (GRCm39) missense probably damaging 1.00
R8898:Pdzph1 UTSW 17 59,281,334 (GRCm39) missense probably benign 0.00
R8959:Pdzph1 UTSW 17 59,281,599 (GRCm39) missense probably damaging 0.97
R9043:Pdzph1 UTSW 17 59,280,535 (GRCm39) missense probably benign 0.05
R9083:Pdzph1 UTSW 17 59,261,395 (GRCm39) missense possibly damaging 0.94
R9092:Pdzph1 UTSW 17 59,280,125 (GRCm39) missense probably damaging 1.00
R9682:Pdzph1 UTSW 17 59,257,262 (GRCm39) missense probably damaging 1.00
R9757:Pdzph1 UTSW 17 59,281,898 (GRCm39) nonsense probably null
R9774:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
X0028:Pdzph1 UTSW 17 59,186,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTCAAACTAAGGTGTCTTTCCTG -3'
(R):5'- GCAGTTACTCAAGCAGCGAG -3'

Sequencing Primer
(F):5'- AACTAAGGTGTCTTTCCTGTTACTG -3'
(R):5'- ATTTGGGACAGTGACTCCCTAATGC -3'
Posted On 2021-01-18