Incidental Mutation 'R8524:Slc7a14'
ID 658704
Institutional Source Beutler Lab
Gene Symbol Slc7a14
Ensembl Gene ENSMUSG00000069072
Gene Name solute carrier family 7 (cationic amino acid transporter, y+ system), member 14
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock # R8524 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 31202858-31310378 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 31224133 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 441 (V441G)
Ref Sequence ENSEMBL: ENSMUSP00000088803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091259] [ENSMUST00000108245]
AlphaFold Q8BXR1
Predicted Effect possibly damaging
Transcript: ENSMUST00000091259
AA Change: V441G

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000088803
Gene: ENSMUSG00000069072
AA Change: V441G

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 443 2.1e-44 PFAM
Pfam:AA_permease 57 436 7.2e-38 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 677 9.2e-21 PFAM
low complexity region 737 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108245
AA Change: V441G

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103880
Gene: ENSMUSG00000069072
AA Change: V441G

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 445 2.5e-46 PFAM
Pfam:AA_permease 57 437 6.9e-41 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 668 1.4e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predicted to encode a glycosylated, cationic amino acid transporter protein with 14 transmembrane domains. This gene is primarily expressed in skin fibroblasts, neural tissue, and primary endothelial cells and its protein is predicted to mediate lysosomal uptake of cationic amino acids. Mutations in this gene are associated with autosomal recessive retinitis pigmentosa. In mice, this gene is expressed in the photoreceptor layer of the retina where its expression increases over the course of retinal development and persists in the mature retina. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye electrophysiology, thin retinal outer nuclear and decreased total retinal thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc65 A T 15: 98,709,109 T66S probably benign Het
Cers1 G A 8: 70,331,248 G282D probably damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Col25a1 C A 3: 130,549,224 P350H probably damaging Het
Coq5 T C 5: 115,284,553 I172T probably damaging Het
Dand5 A T 8: 84,822,427 L85* probably null Het
Dnah8 T A 17: 30,715,498 W1486R possibly damaging Het
Dpp8 T C 9: 65,043,707 Y142H probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gng7 T A 10: 80,951,703 H42L possibly damaging Het
Gps2 T C 11: 69,915,006 V93A probably damaging Het
Hspa9 T C 18: 34,954,244 S3G unknown Het
Impg2 A G 16: 56,218,394 N132D probably benign Het
Jak2 A T 19: 29,295,705 N643I probably damaging Het
Kcng2 T C 18: 80,295,681 D464G probably benign Het
Kdm4b T A 17: 56,399,384 C833S probably damaging Het
Ly86 G A 13: 37,376,893 D77N probably damaging Het
Map7 G A 10: 20,266,823 A330T probably benign Het
Mettl1 T C 10: 127,042,039 S21P probably damaging Het
Mga A G 2: 119,941,516 Y1540C probably damaging Het
Mpp4 A G 1: 59,144,681 L300P probably damaging Het
Mycbp2 A G 14: 103,155,459 M3222T probably benign Het
Nat8f6 A G 6: 85,808,559 Y203H probably benign Het
Nod1 C T 6: 54,948,075 E84K probably damaging Het
Olfr1066 T C 2: 86,455,617 Y218C probably damaging Het
Olfr1367 T C 13: 21,347,078 V50A probably benign Het
Olfr1418 A G 19: 11,855,081 Y291H probably damaging Het
Padi2 A G 4: 140,949,695 N598S possibly damaging Het
Pclo C T 5: 14,679,507 probably benign Het
Pdik1l T G 4: 134,286,610 E12D probably benign Het
Plcg1 G A 2: 160,761,467 probably null Het
Rasgrf1 A G 9: 89,915,585 H172R possibly damaging Het
Rnf41 C G 10: 128,435,430 R70G possibly damaging Het
Rsbn1 A T 3: 103,928,371 K203* probably null Het
Setbp1 T C 18: 78,858,754 D566G probably damaging Het
Sorl1 T A 9: 41,974,074 N2077I probably damaging Het
Spryd3 G A 15: 102,118,148 R363* probably null Het
St6galnac1 G T 11: 116,767,721 R306S possibly damaging Het
Tmem245 T C 4: 56,906,261 Q548R probably benign Het
Trim35 C T 14: 66,307,044 R276C probably damaging Het
Trim55 A T 3: 19,670,949 D210V probably benign Het
Tsg101 A T 7: 46,892,367 D279E probably benign Het
Other mutations in Slc7a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Slc7a14 APN 3 31238678 missense probably damaging 1.00
IGL02713:Slc7a14 APN 3 31257763 missense probably damaging 0.96
IGL03341:Slc7a14 APN 3 31238770 missense probably damaging 1.00
IGL03350:Slc7a14 APN 3 31237409 missense probably benign 0.35
IGL03379:Slc7a14 APN 3 31223515 missense probably damaging 1.00
R0064:Slc7a14 UTSW 3 31227060 missense probably damaging 1.00
R1549:Slc7a14 UTSW 3 31224118 missense possibly damaging 0.94
R1591:Slc7a14 UTSW 3 31237449 missense probably damaging 1.00
R2054:Slc7a14 UTSW 3 31237362 splice site probably benign
R2057:Slc7a14 UTSW 3 31237496 missense probably damaging 1.00
R2442:Slc7a14 UTSW 3 31230320 missense probably damaging 1.00
R2504:Slc7a14 UTSW 3 31237501 missense possibly damaging 0.85
R3848:Slc7a14 UTSW 3 31237474 missense probably damaging 1.00
R4653:Slc7a14 UTSW 3 31257682 missense probably damaging 1.00
R4702:Slc7a14 UTSW 3 31230398 missense probably damaging 1.00
R5043:Slc7a14 UTSW 3 31237466 missense probably damaging 1.00
R5187:Slc7a14 UTSW 3 31237365 splice site probably null
R5345:Slc7a14 UTSW 3 31223857 missense probably damaging 0.99
R5393:Slc7a14 UTSW 3 31257770 missense probably damaging 1.00
R5421:Slc7a14 UTSW 3 31224197 missense probably damaging 1.00
R5736:Slc7a14 UTSW 3 31223910 missense probably benign 0.00
R5771:Slc7a14 UTSW 3 31238707 missense probably damaging 1.00
R5896:Slc7a14 UTSW 3 31257570 missense probably damaging 1.00
R5996:Slc7a14 UTSW 3 31209236 missense probably benign
R6020:Slc7a14 UTSW 3 31224112 missense probably benign
R6107:Slc7a14 UTSW 3 31257610 missense probably damaging 1.00
R6140:Slc7a14 UTSW 3 31237548 missense probably benign
R6491:Slc7a14 UTSW 3 31223944 missense probably damaging 1.00
R6846:Slc7a14 UTSW 3 31224223 missense probably damaging 1.00
R6990:Slc7a14 UTSW 3 31223579 missense possibly damaging 0.90
R7184:Slc7a14 UTSW 3 31227063 missense probably damaging 0.98
R7271:Slc7a14 UTSW 3 31224235 missense probably damaging 1.00
R7282:Slc7a14 UTSW 3 31227153 missense possibly damaging 0.67
R7331:Slc7a14 UTSW 3 31257731 missense probably benign 0.00
R8227:Slc7a14 UTSW 3 31209212 missense probably benign 0.00
R8238:Slc7a14 UTSW 3 31227151 missense probably benign 0.01
R8843:Slc7a14 UTSW 3 31257610 missense probably damaging 1.00
R8903:Slc7a14 UTSW 3 31223446 missense probably damaging 0.98
R9011:Slc7a14 UTSW 3 31224196 missense probably damaging 1.00
R9208:Slc7a14 UTSW 3 31227210 missense probably damaging 1.00
R9633:Slc7a14 UTSW 3 31224017 missense probably benign 0.31
Z1088:Slc7a14 UTSW 3 31223999 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TATCCACAGTGCCGTAGTTG -3'
(R):5'- ACACCAGTGGTAGCTTGCATAG -3'

Sequencing Primer
(F):5'- AGGCGGACTTATCTGATTTCC -3'
(R):5'- AGCTTGCATAGTGTCAGGC -3'
Posted On 2021-01-18