Incidental Mutation 'R8524:Impg2'
ID658733
Institutional Source Beutler Lab
Gene Symbol Impg2
Ensembl Gene ENSMUSG00000035270
Gene Nameinterphotoreceptor matrix proteoglycan 2
SynonymsIPM200, Spacrcan, PG10.2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R8524 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location56204313-56273756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56218394 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 132 (N132D)
Ref Sequence ENSEMBL: ENSMUSP00000125135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069936] [ENSMUST00000160116]
Predicted Effect probably benign
Transcript: ENSMUST00000069936
AA Change: N132D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000063648
Gene: ENSMUSG00000035270
AA Change: N132D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 66 74 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
SEA 235 345 7.7e-29 SMART
low complexity region 396 407 N/A INTRINSIC
low complexity region 419 444 N/A INTRINSIC
SEA 895 1018 2.18e-28 SMART
EGF_like 1016 1054 3.57e1 SMART
EGF_like 1056 1096 3.04e1 SMART
transmembrane domain 1105 1127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160116
AA Change: N132D

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000125135
Gene: ENSMUSG00000035270
AA Change: N132D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 66 74 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
SEA 235 345 7.7e-29 SMART
SEA 786 909 2.18e-28 SMART
EGF_like 907 945 3.57e1 SMART
EGF_like 947 987 3.04e1 SMART
transmembrane domain 996 1018 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds chondroitin sulfate and hyaluronan and is a proteoglycan. The encoded protein plays a role in the organization of the interphotoreceptor matrix and may promote the growth and maintenance of the light-sensitive photoreceptor outer segment. Defects in this gene are a cause of retinitis pigmentosa type 56 and maculopathy, IMPG2-related.[provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc65 A T 15: 98,709,109 T66S probably benign Het
Cers1 G A 8: 70,331,248 G282D probably damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Col25a1 C A 3: 130,549,224 P350H probably damaging Het
Coq5 T C 5: 115,284,553 I172T probably damaging Het
Dand5 A T 8: 84,822,427 L85* probably null Het
Dnah8 T A 17: 30,715,498 W1486R possibly damaging Het
Dpp8 T C 9: 65,043,707 Y142H probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gng7 T A 10: 80,951,703 H42L possibly damaging Het
Gps2 T C 11: 69,915,006 V93A probably damaging Het
Hspa9 T C 18: 34,954,244 S3G unknown Het
Jak2 A T 19: 29,295,705 N643I probably damaging Het
Kcng2 T C 18: 80,295,681 D464G probably benign Het
Kdm4b T A 17: 56,399,384 C833S probably damaging Het
Ly86 G A 13: 37,376,893 D77N probably damaging Het
Map7 G A 10: 20,266,823 A330T probably benign Het
Mettl1 T C 10: 127,042,039 S21P probably damaging Het
Mga A G 2: 119,941,516 Y1540C probably damaging Het
Mpp4 A G 1: 59,144,681 L300P probably damaging Het
Mycbp2 A G 14: 103,155,459 M3222T probably benign Het
Nat8f6 A G 6: 85,808,559 Y203H probably benign Het
Nod1 C T 6: 54,948,075 E84K probably damaging Het
Olfr1066 T C 2: 86,455,617 Y218C probably damaging Het
Olfr1367 T C 13: 21,347,078 V50A probably benign Het
Olfr1418 A G 19: 11,855,081 Y291H probably damaging Het
Padi2 A G 4: 140,949,695 N598S possibly damaging Het
Pclo C T 5: 14,679,507 probably benign Het
Pdik1l T G 4: 134,286,610 E12D probably benign Het
Plcg1 G A 2: 160,761,467 probably null Het
Rasgrf1 A G 9: 89,915,585 H172R possibly damaging Het
Rnf41 C G 10: 128,435,430 R70G possibly damaging Het
Rsbn1 A T 3: 103,928,371 K203* probably null Het
Setbp1 T C 18: 78,858,754 D566G probably damaging Het
Slc7a14 A C 3: 31,224,133 V441G possibly damaging Het
Sorl1 T A 9: 41,974,074 N2077I probably damaging Het
Spryd3 G A 15: 102,118,148 R363* probably null Het
St6galnac1 G T 11: 116,767,721 R306S possibly damaging Het
Tmem245 T C 4: 56,906,261 Q548R probably benign Het
Trim35 C T 14: 66,307,044 R276C probably damaging Het
Trim55 A T 3: 19,670,949 D210V probably benign Het
Tsg101 A T 7: 46,892,367 D279E probably benign Het
Other mutations in Impg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Impg2 APN 16 56261605 nonsense probably null
IGL01097:Impg2 APN 16 56260647 critical splice donor site probably null
IGL01115:Impg2 APN 16 56259440 missense possibly damaging 0.61
IGL01545:Impg2 APN 16 56225717 splice site probably benign
IGL01644:Impg2 APN 16 56259870 missense probably benign 0.04
IGL01690:Impg2 APN 16 56205205 missense probably damaging 0.97
IGL01781:Impg2 APN 16 56252225 missense probably benign 0.21
IGL01801:Impg2 APN 16 56236748 missense probably damaging 0.97
IGL01980:Impg2 APN 16 56221527 missense probably damaging 0.99
IGL02059:Impg2 APN 16 56259972 missense probably damaging 1.00
IGL02140:Impg2 APN 16 56259468 missense probably benign 0.05
IGL02206:Impg2 APN 16 56259597 missense possibly damaging 0.92
IGL02245:Impg2 APN 16 56269082 missense probably damaging 0.96
IGL02584:Impg2 APN 16 56265011 missense probably damaging 1.00
IGL03061:Impg2 APN 16 56268416 missense probably damaging 1.00
IGL03123:Impg2 APN 16 56267122 missense probably damaging 1.00
IGL03280:Impg2 APN 16 56268268 nonsense probably null
R0051:Impg2 UTSW 16 56258048 missense probably damaging 1.00
R0117:Impg2 UTSW 16 56261642 missense probably damaging 0.99
R0193:Impg2 UTSW 16 56265049 nonsense probably null
R0270:Impg2 UTSW 16 56269015 missense possibly damaging 0.88
R0326:Impg2 UTSW 16 56260485 missense probably damaging 1.00
R0330:Impg2 UTSW 16 56252264 missense probably damaging 0.99
R0812:Impg2 UTSW 16 56257939 intron probably benign
R1074:Impg2 UTSW 16 56265178 splice site probably benign
R1283:Impg2 UTSW 16 56257939 intron probably benign
R1618:Impg2 UTSW 16 56259858 missense probably damaging 0.97
R1708:Impg2 UTSW 16 56265078 missense probably benign 0.10
R1713:Impg2 UTSW 16 56260526 missense probably benign 0.25
R1827:Impg2 UTSW 16 56267220 missense possibly damaging 0.62
R1853:Impg2 UTSW 16 56260277 missense probably damaging 1.00
R2064:Impg2 UTSW 16 56243630 critical splice donor site probably null
R2100:Impg2 UTSW 16 56231385 splice site probably null
R2125:Impg2 UTSW 16 56265064 missense probably damaging 1.00
R2128:Impg2 UTSW 16 56218379 missense probably damaging 1.00
R2195:Impg2 UTSW 16 56260134 missense probably benign 0.39
R2247:Impg2 UTSW 16 56268264 missense probably damaging 0.97
R2366:Impg2 UTSW 16 56259873 missense probably benign 0.04
R2411:Impg2 UTSW 16 56252154 missense probably damaging 1.00
R4193:Impg2 UTSW 16 56268411 missense probably benign 0.00
R4356:Impg2 UTSW 16 56260164 missense probably damaging 1.00
R4424:Impg2 UTSW 16 56260025 missense possibly damaging 0.56
R4575:Impg2 UTSW 16 56261732 missense probably damaging 1.00
R4766:Impg2 UTSW 16 56257939 intron probably benign
R5024:Impg2 UTSW 16 56260100 missense probably damaging 0.97
R5278:Impg2 UTSW 16 56221517 missense probably benign 0.06
R5383:Impg2 UTSW 16 56243626 missense probably benign 0.03
R5766:Impg2 UTSW 16 56259820 missense possibly damaging 0.73
R5909:Impg2 UTSW 16 56258136 missense probably damaging 0.99
R6525:Impg2 UTSW 16 56205149 missense probably damaging 1.00
R6684:Impg2 UTSW 16 56259929 missense probably benign 0.33
R6692:Impg2 UTSW 16 56252333 missense probably damaging 1.00
R6711:Impg2 UTSW 16 56265086 missense probably damaging 1.00
R6909:Impg2 UTSW 16 56204584 missense probably damaging 0.97
R6959:Impg2 UTSW 16 56268330 missense probably benign 0.01
R7226:Impg2 UTSW 16 56267104 nonsense probably null
R7456:Impg2 UTSW 16 56259913 missense probably benign 0.03
R7528:Impg2 UTSW 16 56260380 missense possibly damaging 0.86
R7532:Impg2 UTSW 16 56267180 missense probably damaging 0.96
R7601:Impg2 UTSW 16 56260031 missense probably benign 0.22
R7803:Impg2 UTSW 16 56267150 missense probably damaging 0.99
R8063:Impg2 UTSW 16 56261456 intron probably benign
R8251:Impg2 UTSW 16 56259597 missense possibly damaging 0.92
R8292:Impg2 UTSW 16 56260626 missense probably damaging 1.00
R8481:Impg2 UTSW 16 56252266 missense possibly damaging 0.76
R8782:Impg2 UTSW 16 56259455 missense probably damaging 0.99
R8795:Impg2 UTSW 16 56260248 missense probably benign 0.25
R8901:Impg2 UTSW 16 56252165 missense probably damaging 1.00
X0023:Impg2 UTSW 16 56259876 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCTCATGACCCTGCAGAAAGG -3'
(R):5'- TAAGCTATTCCCCAGGGCAG -3'

Sequencing Primer
(F):5'- CCCTGCAGAAAGGATAGTGTGATC -3'
(R):5'- GCCCACTCAGATCCTAACCTTCG -3'
Posted On2021-01-18